ID: 904968609

View in Genome Browser
Species Human (GRCh38)
Location 1:34401041-34401063
Sequence GCTGAGCTTCACCACGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904968604_904968609 12 Left 904968604 1:34401006-34401028 CCACAGAGGCATCTTTTTACTTG No data
Right 904968609 1:34401041-34401063 GCTGAGCTTCACCACGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904968609 Original CRISPR GCTGAGCTTCACCACGAGGA TGG Intergenic
No off target data available for this crispr