ID: 904968914

View in Genome Browser
Species Human (GRCh38)
Location 1:34403500-34403522
Sequence ACTCCAGGTGTGGCTCAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904968914_904968925 22 Left 904968914 1:34403500-34403522 CCCCCTTGAGCCACACCTGGAGT No data
Right 904968925 1:34403545-34403567 ATTTCAGGAGCAGAGACTTGAGG No data
904968914_904968923 7 Left 904968914 1:34403500-34403522 CCCCCTTGAGCCACACCTGGAGT No data
Right 904968923 1:34403530-34403552 GAGCATTTTGCCAAAATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904968914 Original CRISPR ACTCCAGGTGTGGCTCAAGG GGG (reversed) Intergenic
No off target data available for this crispr