ID: 904969309

View in Genome Browser
Species Human (GRCh38)
Location 1:34406495-34406517
Sequence TAATCTAGATGAGGCCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904969309_904969314 23 Left 904969309 1:34406495-34406517 CCCACAGGGCCTCATCTAGATTA No data
Right 904969314 1:34406541-34406563 ACTTTCTGCCCTGATTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904969309 Original CRISPR TAATCTAGATGAGGCCCTGT GGG (reversed) Intergenic