ID: 904969346

View in Genome Browser
Species Human (GRCh38)
Location 1:34406759-34406781
Sequence AAGCAGAACAATAAACAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904969346_904969349 -10 Left 904969346 1:34406759-34406781 CCTTCCTGTTTATTGTTCTGCTT No data
Right 904969349 1:34406772-34406794 TGTTCTGCTTTGGCCATTAATGG No data
904969346_904969351 -8 Left 904969346 1:34406759-34406781 CCTTCCTGTTTATTGTTCTGCTT No data
Right 904969351 1:34406774-34406796 TTCTGCTTTGGCCATTAATGGGG No data
904969346_904969350 -9 Left 904969346 1:34406759-34406781 CCTTCCTGTTTATTGTTCTGCTT No data
Right 904969350 1:34406773-34406795 GTTCTGCTTTGGCCATTAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904969346 Original CRISPR AAGCAGAACAATAAACAGGA AGG (reversed) Intergenic
No off target data available for this crispr