ID: 904969421

View in Genome Browser
Species Human (GRCh38)
Location 1:34407435-34407457
Sequence GTAGTTCAGAGGTTCTCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904969417_904969421 5 Left 904969417 1:34407407-34407429 CCATCTGGTGTAACATTCTGCCA No data
Right 904969421 1:34407435-34407457 GTAGTTCAGAGGTTCTCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904969421 Original CRISPR GTAGTTCAGAGGTTCTCACA GGG Intergenic
No off target data available for this crispr