ID: 904970053

View in Genome Browser
Species Human (GRCh38)
Location 1:34412470-34412492
Sequence CACAGACGGTGCCCCCACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904970053_904970059 22 Left 904970053 1:34412470-34412492 CCCCAGTGGGGGCACCGTCTGTG No data
Right 904970059 1:34412515-34412537 ATGTTTCAAACATGGTTCCAAGG No data
904970053_904970058 14 Left 904970053 1:34412470-34412492 CCCCAGTGGGGGCACCGTCTGTG No data
Right 904970058 1:34412507-34412529 GCAGTGCAATGTTTCAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904970053 Original CRISPR CACAGACGGTGCCCCCACTG GGG (reversed) Intergenic