ID: 904970055 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:34412472-34412494 |
| Sequence | TTCACAGACGGTGCCCCCAC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 904970055_904970059 | 20 | Left | 904970055 | 1:34412472-34412494 | CCAGTGGGGGCACCGTCTGTGAA | No data | ||
| Right | 904970059 | 1:34412515-34412537 | ATGTTTCAAACATGGTTCCAAGG | No data | ||||
| 904970055_904970058 | 12 | Left | 904970055 | 1:34412472-34412494 | CCAGTGGGGGCACCGTCTGTGAA | No data | ||
| Right | 904970058 | 1:34412507-34412529 | GCAGTGCAATGTTTCAAACATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 904970055 | Original CRISPR | TTCACAGACGGTGCCCCCAC TGG (reversed) | Intergenic | ||