ID: 904970055

View in Genome Browser
Species Human (GRCh38)
Location 1:34412472-34412494
Sequence TTCACAGACGGTGCCCCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904970055_904970059 20 Left 904970055 1:34412472-34412494 CCAGTGGGGGCACCGTCTGTGAA No data
Right 904970059 1:34412515-34412537 ATGTTTCAAACATGGTTCCAAGG No data
904970055_904970058 12 Left 904970055 1:34412472-34412494 CCAGTGGGGGCACCGTCTGTGAA No data
Right 904970058 1:34412507-34412529 GCAGTGCAATGTTTCAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904970055 Original CRISPR TTCACAGACGGTGCCCCCAC TGG (reversed) Intergenic
No off target data available for this crispr