ID: 904970056

View in Genome Browser
Species Human (GRCh38)
Location 1:34412484-34412506
Sequence TACAGAGGAGTTTTCACAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904970056_904970058 0 Left 904970056 1:34412484-34412506 CCGTCTGTGAAAACTCCTCTGTA No data
Right 904970058 1:34412507-34412529 GCAGTGCAATGTTTCAAACATGG No data
904970056_904970059 8 Left 904970056 1:34412484-34412506 CCGTCTGTGAAAACTCCTCTGTA No data
Right 904970059 1:34412515-34412537 ATGTTTCAAACATGGTTCCAAGG No data
904970056_904970061 26 Left 904970056 1:34412484-34412506 CCGTCTGTGAAAACTCCTCTGTA No data
Right 904970061 1:34412533-34412555 CAAGGACTCAACTTTGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904970056 Original CRISPR TACAGAGGAGTTTTCACAGA CGG (reversed) Intergenic