ID: 904970057

View in Genome Browser
Species Human (GRCh38)
Location 1:34412499-34412521
Sequence GAAACATTGCACTGCTACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904970057_904970061 11 Left 904970057 1:34412499-34412521 CCTCTGTAGCAGTGCAATGTTTC No data
Right 904970061 1:34412533-34412555 CAAGGACTCAACTTTGACAAAGG No data
904970057_904970059 -7 Left 904970057 1:34412499-34412521 CCTCTGTAGCAGTGCAATGTTTC No data
Right 904970059 1:34412515-34412537 ATGTTTCAAACATGGTTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904970057 Original CRISPR GAAACATTGCACTGCTACAG AGG (reversed) Intergenic