ID: 904970058

View in Genome Browser
Species Human (GRCh38)
Location 1:34412507-34412529
Sequence GCAGTGCAATGTTTCAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904970056_904970058 0 Left 904970056 1:34412484-34412506 CCGTCTGTGAAAACTCCTCTGTA No data
Right 904970058 1:34412507-34412529 GCAGTGCAATGTTTCAAACATGG No data
904970055_904970058 12 Left 904970055 1:34412472-34412494 CCAGTGGGGGCACCGTCTGTGAA No data
Right 904970058 1:34412507-34412529 GCAGTGCAATGTTTCAAACATGG No data
904970054_904970058 13 Left 904970054 1:34412471-34412493 CCCAGTGGGGGCACCGTCTGTGA No data
Right 904970058 1:34412507-34412529 GCAGTGCAATGTTTCAAACATGG No data
904970053_904970058 14 Left 904970053 1:34412470-34412492 CCCCAGTGGGGGCACCGTCTGTG No data
Right 904970058 1:34412507-34412529 GCAGTGCAATGTTTCAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904970058 Original CRISPR GCAGTGCAATGTTTCAAACA TGG Intergenic