ID: 904970059

View in Genome Browser
Species Human (GRCh38)
Location 1:34412515-34412537
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904970055_904970059 20 Left 904970055 1:34412472-34412494 CCAGTGGGGGCACCGTCTGTGAA No data
Right 904970059 1:34412515-34412537 ATGTTTCAAACATGGTTCCAAGG No data
904970054_904970059 21 Left 904970054 1:34412471-34412493 CCCAGTGGGGGCACCGTCTGTGA No data
Right 904970059 1:34412515-34412537 ATGTTTCAAACATGGTTCCAAGG No data
904970053_904970059 22 Left 904970053 1:34412470-34412492 CCCCAGTGGGGGCACCGTCTGTG No data
Right 904970059 1:34412515-34412537 ATGTTTCAAACATGGTTCCAAGG No data
904970057_904970059 -7 Left 904970057 1:34412499-34412521 CCTCTGTAGCAGTGCAATGTTTC No data
Right 904970059 1:34412515-34412537 ATGTTTCAAACATGGTTCCAAGG No data
904970056_904970059 8 Left 904970056 1:34412484-34412506 CCGTCTGTGAAAACTCCTCTGTA No data
Right 904970059 1:34412515-34412537 ATGTTTCAAACATGGTTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr