ID: 904970072

View in Genome Browser
Species Human (GRCh38)
Location 1:34412610-34412632
Sequence CAACATAAAGAGAGGAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904970072_904970079 3 Left 904970072 1:34412610-34412632 CCCAGCCTCCTCTCTTTATGTTG No data
Right 904970079 1:34412636-34412658 AGGGAATTATCTAGAGAGATGGG No data
904970072_904970080 9 Left 904970072 1:34412610-34412632 CCCAGCCTCCTCTCTTTATGTTG No data
Right 904970080 1:34412642-34412664 TTATCTAGAGAGATGGGAGATGG No data
904970072_904970078 2 Left 904970072 1:34412610-34412632 CCCAGCCTCCTCTCTTTATGTTG No data
Right 904970078 1:34412635-34412657 GAGGGAATTATCTAGAGAGATGG No data
904970072_904970081 10 Left 904970072 1:34412610-34412632 CCCAGCCTCCTCTCTTTATGTTG No data
Right 904970081 1:34412643-34412665 TATCTAGAGAGATGGGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904970072 Original CRISPR CAACATAAAGAGAGGAGGCT GGG (reversed) Intergenic
No off target data available for this crispr