ID: 904970078

View in Genome Browser
Species Human (GRCh38)
Location 1:34412635-34412657
Sequence GAGGGAATTATCTAGAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904970072_904970078 2 Left 904970072 1:34412610-34412632 CCCAGCCTCCTCTCTTTATGTTG No data
Right 904970078 1:34412635-34412657 GAGGGAATTATCTAGAGAGATGG No data
904970077_904970078 -6 Left 904970077 1:34412618-34412640 CCTCTCTTTATGTTGACGAGGGA No data
Right 904970078 1:34412635-34412657 GAGGGAATTATCTAGAGAGATGG No data
904970070_904970078 7 Left 904970070 1:34412605-34412627 CCCTGCCCAGCCTCCTCTCTTTA No data
Right 904970078 1:34412635-34412657 GAGGGAATTATCTAGAGAGATGG No data
904970067_904970078 19 Left 904970067 1:34412593-34412615 CCACAGCTCCCTCCCTGCCCAGC No data
Right 904970078 1:34412635-34412657 GAGGGAATTATCTAGAGAGATGG No data
904970069_904970078 10 Left 904970069 1:34412602-34412624 CCTCCCTGCCCAGCCTCCTCTCT No data
Right 904970078 1:34412635-34412657 GAGGGAATTATCTAGAGAGATGG No data
904970068_904970078 11 Left 904970068 1:34412601-34412623 CCCTCCCTGCCCAGCCTCCTCTC No data
Right 904970078 1:34412635-34412657 GAGGGAATTATCTAGAGAGATGG No data
904970074_904970078 -3 Left 904970074 1:34412615-34412637 CCTCCTCTCTTTATGTTGACGAG No data
Right 904970078 1:34412635-34412657 GAGGGAATTATCTAGAGAGATGG No data
904970073_904970078 1 Left 904970073 1:34412611-34412633 CCAGCCTCCTCTCTTTATGTTGA No data
Right 904970078 1:34412635-34412657 GAGGGAATTATCTAGAGAGATGG No data
904970071_904970078 6 Left 904970071 1:34412606-34412628 CCTGCCCAGCCTCCTCTCTTTAT No data
Right 904970078 1:34412635-34412657 GAGGGAATTATCTAGAGAGATGG No data
904970066_904970078 23 Left 904970066 1:34412589-34412611 CCTTCCACAGCTCCCTCCCTGCC No data
Right 904970078 1:34412635-34412657 GAGGGAATTATCTAGAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904970078 Original CRISPR GAGGGAATTATCTAGAGAGA TGG Intergenic
No off target data available for this crispr