ID: 904970081

View in Genome Browser
Species Human (GRCh38)
Location 1:34412643-34412665
Sequence TATCTAGAGAGATGGGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904970068_904970081 19 Left 904970068 1:34412601-34412623 CCCTCCCTGCCCAGCCTCCTCTC No data
Right 904970081 1:34412643-34412665 TATCTAGAGAGATGGGAGATGGG No data
904970067_904970081 27 Left 904970067 1:34412593-34412615 CCACAGCTCCCTCCCTGCCCAGC No data
Right 904970081 1:34412643-34412665 TATCTAGAGAGATGGGAGATGGG No data
904970077_904970081 2 Left 904970077 1:34412618-34412640 CCTCTCTTTATGTTGACGAGGGA No data
Right 904970081 1:34412643-34412665 TATCTAGAGAGATGGGAGATGGG No data
904970074_904970081 5 Left 904970074 1:34412615-34412637 CCTCCTCTCTTTATGTTGACGAG No data
Right 904970081 1:34412643-34412665 TATCTAGAGAGATGGGAGATGGG No data
904970070_904970081 15 Left 904970070 1:34412605-34412627 CCCTGCCCAGCCTCCTCTCTTTA No data
Right 904970081 1:34412643-34412665 TATCTAGAGAGATGGGAGATGGG No data
904970073_904970081 9 Left 904970073 1:34412611-34412633 CCAGCCTCCTCTCTTTATGTTGA No data
Right 904970081 1:34412643-34412665 TATCTAGAGAGATGGGAGATGGG No data
904970069_904970081 18 Left 904970069 1:34412602-34412624 CCTCCCTGCCCAGCCTCCTCTCT No data
Right 904970081 1:34412643-34412665 TATCTAGAGAGATGGGAGATGGG No data
904970072_904970081 10 Left 904970072 1:34412610-34412632 CCCAGCCTCCTCTCTTTATGTTG No data
Right 904970081 1:34412643-34412665 TATCTAGAGAGATGGGAGATGGG No data
904970071_904970081 14 Left 904970071 1:34412606-34412628 CCTGCCCAGCCTCCTCTCTTTAT No data
Right 904970081 1:34412643-34412665 TATCTAGAGAGATGGGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904970081 Original CRISPR TATCTAGAGAGATGGGAGAT GGG Intergenic
No off target data available for this crispr