ID: 904976106

View in Genome Browser
Species Human (GRCh38)
Location 1:34457828-34457850
Sequence CACCCCCATAATATGTTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904976094_904976106 -9 Left 904976094 1:34457814-34457836 CCGCGCCCCCCCCCCACCCCCAT No data
Right 904976106 1:34457828-34457850 CACCCCCATAATATGTTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904976106 Original CRISPR CACCCCCATAATATGTTTTG GGG Intergenic
No off target data available for this crispr