ID: 904977922

View in Genome Browser
Species Human (GRCh38)
Location 1:34472703-34472725
Sequence CTGTGTGAATCAAGGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904977917_904977922 -5 Left 904977917 1:34472685-34472707 CCGCCTTGGTAGGCAAGTCTGTG No data
Right 904977922 1:34472703-34472725 CTGTGTGAATCAAGGGAGGATGG No data
904977916_904977922 -4 Left 904977916 1:34472684-34472706 CCCGCCTTGGTAGGCAAGTCTGT No data
Right 904977922 1:34472703-34472725 CTGTGTGAATCAAGGGAGGATGG No data
904977912_904977922 17 Left 904977912 1:34472663-34472685 CCAGCAAAGCAGGAGCAGAGCCC No data
Right 904977922 1:34472703-34472725 CTGTGTGAATCAAGGGAGGATGG No data
904977915_904977922 -3 Left 904977915 1:34472683-34472705 CCCCGCCTTGGTAGGCAAGTCTG No data
Right 904977922 1:34472703-34472725 CTGTGTGAATCAAGGGAGGATGG No data
904977918_904977922 -8 Left 904977918 1:34472688-34472710 CCTTGGTAGGCAAGTCTGTGTGA No data
Right 904977922 1:34472703-34472725 CTGTGTGAATCAAGGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904977922 Original CRISPR CTGTGTGAATCAAGGGAGGA TGG Intergenic
No off target data available for this crispr