ID: 904982974

View in Genome Browser
Species Human (GRCh38)
Location 1:34522351-34522373
Sequence ATCAAGGCCGTGCACACAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904982972_904982974 28 Left 904982972 1:34522300-34522322 CCGCTTGAAAGGAAGAAGAGTAG No data
Right 904982974 1:34522351-34522373 ATCAAGGCCGTGCACACAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904982974 Original CRISPR ATCAAGGCCGTGCACACAGT AGG Intergenic
No off target data available for this crispr