ID: 904983066

View in Genome Browser
Species Human (GRCh38)
Location 1:34522967-34522989
Sequence TTGCAGGACTGCAGGGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904983059_904983066 21 Left 904983059 1:34522923-34522945 CCTCCTTTGCACCAGTATCTGTG No data
Right 904983066 1:34522967-34522989 TTGCAGGACTGCAGGGAAGTTGG No data
904983058_904983066 22 Left 904983058 1:34522922-34522944 CCCTCCTTTGCACCAGTATCTGT No data
Right 904983066 1:34522967-34522989 TTGCAGGACTGCAGGGAAGTTGG No data
904983061_904983066 10 Left 904983061 1:34522934-34522956 CCAGTATCTGTGCTGTGCTTGTC No data
Right 904983066 1:34522967-34522989 TTGCAGGACTGCAGGGAAGTTGG No data
904983060_904983066 18 Left 904983060 1:34522926-34522948 CCTTTGCACCAGTATCTGTGCTG No data
Right 904983066 1:34522967-34522989 TTGCAGGACTGCAGGGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904983066 Original CRISPR TTGCAGGACTGCAGGGAAGT TGG Intergenic
No off target data available for this crispr