ID: 904983474

View in Genome Browser
Species Human (GRCh38)
Location 1:34525802-34525824
Sequence TGGAGGGGTGGTAGTCCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904983474_904983486 30 Left 904983474 1:34525802-34525824 CCGCCCGGACTACCACCCCTCCA No data
Right 904983486 1:34525855-34525877 GCAAACCTGCTTCCCAGGATGGG No data
904983474_904983484 25 Left 904983474 1:34525802-34525824 CCGCCCGGACTACCACCCCTCCA No data
Right 904983484 1:34525850-34525872 TCTCTGCAAACCTGCTTCCCAGG No data
904983474_904983485 29 Left 904983474 1:34525802-34525824 CCGCCCGGACTACCACCCCTCCA No data
Right 904983485 1:34525854-34525876 TGCAAACCTGCTTCCCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904983474 Original CRISPR TGGAGGGGTGGTAGTCCGGG CGG (reversed) Intergenic
No off target data available for this crispr