ID: 904983475

View in Genome Browser
Species Human (GRCh38)
Location 1:34525805-34525827
Sequence CTCTGGAGGGGTGGTAGTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904983475_904983485 26 Left 904983475 1:34525805-34525827 CCCGGACTACCACCCCTCCAGAG No data
Right 904983485 1:34525854-34525876 TGCAAACCTGCTTCCCAGGATGG No data
904983475_904983487 28 Left 904983475 1:34525805-34525827 CCCGGACTACCACCCCTCCAGAG No data
Right 904983487 1:34525856-34525878 CAAACCTGCTTCCCAGGATGGGG No data
904983475_904983486 27 Left 904983475 1:34525805-34525827 CCCGGACTACCACCCCTCCAGAG No data
Right 904983486 1:34525855-34525877 GCAAACCTGCTTCCCAGGATGGG No data
904983475_904983484 22 Left 904983475 1:34525805-34525827 CCCGGACTACCACCCCTCCAGAG No data
Right 904983484 1:34525850-34525872 TCTCTGCAAACCTGCTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904983475 Original CRISPR CTCTGGAGGGGTGGTAGTCC GGG (reversed) Intergenic
No off target data available for this crispr