ID: 904983476

View in Genome Browser
Species Human (GRCh38)
Location 1:34525806-34525828
Sequence ACTCTGGAGGGGTGGTAGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904983476_904983487 27 Left 904983476 1:34525806-34525828 CCGGACTACCACCCCTCCAGAGT No data
Right 904983487 1:34525856-34525878 CAAACCTGCTTCCCAGGATGGGG No data
904983476_904983484 21 Left 904983476 1:34525806-34525828 CCGGACTACCACCCCTCCAGAGT No data
Right 904983484 1:34525850-34525872 TCTCTGCAAACCTGCTTCCCAGG No data
904983476_904983486 26 Left 904983476 1:34525806-34525828 CCGGACTACCACCCCTCCAGAGT No data
Right 904983486 1:34525855-34525877 GCAAACCTGCTTCCCAGGATGGG No data
904983476_904983485 25 Left 904983476 1:34525806-34525828 CCGGACTACCACCCCTCCAGAGT No data
Right 904983485 1:34525854-34525876 TGCAAACCTGCTTCCCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904983476 Original CRISPR ACTCTGGAGGGGTGGTAGTC CGG (reversed) Intergenic
No off target data available for this crispr