ID: 904983478

View in Genome Browser
Species Human (GRCh38)
Location 1:34525817-34525839
Sequence TGATTTACAACACTCTGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904983478_904983492 24 Left 904983478 1:34525817-34525839 CCCCTCCAGAGTGTTGTAAATCA No data
Right 904983492 1:34525864-34525886 CTTCCCAGGATGGGGAGAGGGGG No data
904983478_904983489 21 Left 904983478 1:34525817-34525839 CCCCTCCAGAGTGTTGTAAATCA No data
Right 904983489 1:34525861-34525883 CTGCTTCCCAGGATGGGGAGAGG No data
904983478_904983484 10 Left 904983478 1:34525817-34525839 CCCCTCCAGAGTGTTGTAAATCA No data
Right 904983484 1:34525850-34525872 TCTCTGCAAACCTGCTTCCCAGG No data
904983478_904983491 23 Left 904983478 1:34525817-34525839 CCCCTCCAGAGTGTTGTAAATCA No data
Right 904983491 1:34525863-34525885 GCTTCCCAGGATGGGGAGAGGGG No data
904983478_904983487 16 Left 904983478 1:34525817-34525839 CCCCTCCAGAGTGTTGTAAATCA No data
Right 904983487 1:34525856-34525878 CAAACCTGCTTCCCAGGATGGGG No data
904983478_904983490 22 Left 904983478 1:34525817-34525839 CCCCTCCAGAGTGTTGTAAATCA No data
Right 904983490 1:34525862-34525884 TGCTTCCCAGGATGGGGAGAGGG No data
904983478_904983486 15 Left 904983478 1:34525817-34525839 CCCCTCCAGAGTGTTGTAAATCA No data
Right 904983486 1:34525855-34525877 GCAAACCTGCTTCCCAGGATGGG No data
904983478_904983485 14 Left 904983478 1:34525817-34525839 CCCCTCCAGAGTGTTGTAAATCA No data
Right 904983485 1:34525854-34525876 TGCAAACCTGCTTCCCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904983478 Original CRISPR TGATTTACAACACTCTGGAG GGG (reversed) Intergenic
No off target data available for this crispr