ID: 904983484

View in Genome Browser
Species Human (GRCh38)
Location 1:34525850-34525872
Sequence TCTCTGCAAACCTGCTTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904983476_904983484 21 Left 904983476 1:34525806-34525828 CCGGACTACCACCCCTCCAGAGT No data
Right 904983484 1:34525850-34525872 TCTCTGCAAACCTGCTTCCCAGG No data
904983477_904983484 13 Left 904983477 1:34525814-34525836 CCACCCCTCCAGAGTGTTGTAAA No data
Right 904983484 1:34525850-34525872 TCTCTGCAAACCTGCTTCCCAGG No data
904983474_904983484 25 Left 904983474 1:34525802-34525824 CCGCCCGGACTACCACCCCTCCA No data
Right 904983484 1:34525850-34525872 TCTCTGCAAACCTGCTTCCCAGG No data
904983480_904983484 8 Left 904983480 1:34525819-34525841 CCTCCAGAGTGTTGTAAATCATA No data
Right 904983484 1:34525850-34525872 TCTCTGCAAACCTGCTTCCCAGG No data
904983478_904983484 10 Left 904983478 1:34525817-34525839 CCCCTCCAGAGTGTTGTAAATCA No data
Right 904983484 1:34525850-34525872 TCTCTGCAAACCTGCTTCCCAGG No data
904983470_904983484 29 Left 904983470 1:34525798-34525820 CCCCCCGCCCGGACTACCACCCC No data
Right 904983484 1:34525850-34525872 TCTCTGCAAACCTGCTTCCCAGG No data
904983472_904983484 27 Left 904983472 1:34525800-34525822 CCCCGCCCGGACTACCACCCCTC No data
Right 904983484 1:34525850-34525872 TCTCTGCAAACCTGCTTCCCAGG No data
904983471_904983484 28 Left 904983471 1:34525799-34525821 CCCCCGCCCGGACTACCACCCCT No data
Right 904983484 1:34525850-34525872 TCTCTGCAAACCTGCTTCCCAGG No data
904983479_904983484 9 Left 904983479 1:34525818-34525840 CCCTCCAGAGTGTTGTAAATCAT No data
Right 904983484 1:34525850-34525872 TCTCTGCAAACCTGCTTCCCAGG No data
904983481_904983484 5 Left 904983481 1:34525822-34525844 CCAGAGTGTTGTAAATCATATCT No data
Right 904983484 1:34525850-34525872 TCTCTGCAAACCTGCTTCCCAGG No data
904983475_904983484 22 Left 904983475 1:34525805-34525827 CCCGGACTACCACCCCTCCAGAG No data
Right 904983484 1:34525850-34525872 TCTCTGCAAACCTGCTTCCCAGG No data
904983473_904983484 26 Left 904983473 1:34525801-34525823 CCCGCCCGGACTACCACCCCTCC No data
Right 904983484 1:34525850-34525872 TCTCTGCAAACCTGCTTCCCAGG No data
904983469_904983484 30 Left 904983469 1:34525797-34525819 CCCCCCCGCCCGGACTACCACCC No data
Right 904983484 1:34525850-34525872 TCTCTGCAAACCTGCTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904983484 Original CRISPR TCTCTGCAAACCTGCTTCCC AGG Intergenic
No off target data available for this crispr