ID: 904983486

View in Genome Browser
Species Human (GRCh38)
Location 1:34525855-34525877
Sequence GCAAACCTGCTTCCCAGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904983478_904983486 15 Left 904983478 1:34525817-34525839 CCCCTCCAGAGTGTTGTAAATCA No data
Right 904983486 1:34525855-34525877 GCAAACCTGCTTCCCAGGATGGG No data
904983476_904983486 26 Left 904983476 1:34525806-34525828 CCGGACTACCACCCCTCCAGAGT No data
Right 904983486 1:34525855-34525877 GCAAACCTGCTTCCCAGGATGGG No data
904983481_904983486 10 Left 904983481 1:34525822-34525844 CCAGAGTGTTGTAAATCATATCT No data
Right 904983486 1:34525855-34525877 GCAAACCTGCTTCCCAGGATGGG No data
904983480_904983486 13 Left 904983480 1:34525819-34525841 CCTCCAGAGTGTTGTAAATCATA No data
Right 904983486 1:34525855-34525877 GCAAACCTGCTTCCCAGGATGGG No data
904983477_904983486 18 Left 904983477 1:34525814-34525836 CCACCCCTCCAGAGTGTTGTAAA No data
Right 904983486 1:34525855-34525877 GCAAACCTGCTTCCCAGGATGGG No data
904983474_904983486 30 Left 904983474 1:34525802-34525824 CCGCCCGGACTACCACCCCTCCA No data
Right 904983486 1:34525855-34525877 GCAAACCTGCTTCCCAGGATGGG No data
904983475_904983486 27 Left 904983475 1:34525805-34525827 CCCGGACTACCACCCCTCCAGAG No data
Right 904983486 1:34525855-34525877 GCAAACCTGCTTCCCAGGATGGG No data
904983479_904983486 14 Left 904983479 1:34525818-34525840 CCCTCCAGAGTGTTGTAAATCAT No data
Right 904983486 1:34525855-34525877 GCAAACCTGCTTCCCAGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904983486 Original CRISPR GCAAACCTGCTTCCCAGGAT GGG Intergenic
No off target data available for this crispr