ID: 904983491

View in Genome Browser
Species Human (GRCh38)
Location 1:34525863-34525885
Sequence GCTTCCCAGGATGGGGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904983479_904983491 22 Left 904983479 1:34525818-34525840 CCCTCCAGAGTGTTGTAAATCAT No data
Right 904983491 1:34525863-34525885 GCTTCCCAGGATGGGGAGAGGGG No data
904983482_904983491 -6 Left 904983482 1:34525846-34525868 CCCATCTCTGCAAACCTGCTTCC No data
Right 904983491 1:34525863-34525885 GCTTCCCAGGATGGGGAGAGGGG No data
904983481_904983491 18 Left 904983481 1:34525822-34525844 CCAGAGTGTTGTAAATCATATCT No data
Right 904983491 1:34525863-34525885 GCTTCCCAGGATGGGGAGAGGGG No data
904983477_904983491 26 Left 904983477 1:34525814-34525836 CCACCCCTCCAGAGTGTTGTAAA No data
Right 904983491 1:34525863-34525885 GCTTCCCAGGATGGGGAGAGGGG No data
904983478_904983491 23 Left 904983478 1:34525817-34525839 CCCCTCCAGAGTGTTGTAAATCA No data
Right 904983491 1:34525863-34525885 GCTTCCCAGGATGGGGAGAGGGG No data
904983483_904983491 -7 Left 904983483 1:34525847-34525869 CCATCTCTGCAAACCTGCTTCCC No data
Right 904983491 1:34525863-34525885 GCTTCCCAGGATGGGGAGAGGGG No data
904983480_904983491 21 Left 904983480 1:34525819-34525841 CCTCCAGAGTGTTGTAAATCATA No data
Right 904983491 1:34525863-34525885 GCTTCCCAGGATGGGGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904983491 Original CRISPR GCTTCCCAGGATGGGGAGAG GGG Intergenic
No off target data available for this crispr