ID: 904987651

View in Genome Browser
Species Human (GRCh38)
Location 1:34565136-34565158
Sequence TACCCACATCACCCATGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904987644_904987651 22 Left 904987644 1:34565091-34565113 CCAATGGAAGTGGCAGAGACAGA No data
Right 904987651 1:34565136-34565158 TACCCACATCACCCATGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904987651 Original CRISPR TACCCACATCACCCATGGCA GGG Intergenic
No off target data available for this crispr