ID: 904993009

View in Genome Browser
Species Human (GRCh38)
Location 1:34608879-34608901
Sequence TTGAATAGGAATAAGGAAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904993009_904993012 0 Left 904993009 1:34608879-34608901 CCGTTTTCCTTATTCCTATTCAA No data
Right 904993012 1:34608902-34608924 AAGAAAATTTCATTGTAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904993009 Original CRISPR TTGAATAGGAATAAGGAAAA CGG (reversed) Intergenic
No off target data available for this crispr