ID: 905000647

View in Genome Browser
Species Human (GRCh38)
Location 1:34665962-34665984
Sequence AGTCTAAGTGGACCAACAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905000642_905000647 17 Left 905000642 1:34665922-34665944 CCAACAAGGAAGAGCAACCATAG No data
Right 905000647 1:34665962-34665984 AGTCTAAGTGGACCAACAGATGG No data
905000644_905000647 -10 Left 905000644 1:34665949-34665971 CCAGTGACCATGCAGTCTAAGTG No data
Right 905000647 1:34665962-34665984 AGTCTAAGTGGACCAACAGATGG No data
905000643_905000647 0 Left 905000643 1:34665939-34665961 CCATAGTTGACCAGTGACCATGC No data
Right 905000647 1:34665962-34665984 AGTCTAAGTGGACCAACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905000647 Original CRISPR AGTCTAAGTGGACCAACAGA TGG Intergenic
No off target data available for this crispr