ID: 905002214

View in Genome Browser
Species Human (GRCh38)
Location 1:34681579-34681601
Sequence CTGTTGCTCTGCAGGTAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905002214_905002220 3 Left 905002214 1:34681579-34681601 CCCATTTACCTGCAGAGCAACAG No data
Right 905002220 1:34681605-34681627 AGGGCCCTGTATACCCTGCTGGG No data
905002214_905002219 2 Left 905002214 1:34681579-34681601 CCCATTTACCTGCAGAGCAACAG No data
Right 905002219 1:34681604-34681626 CAGGGCCCTGTATACCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905002214 Original CRISPR CTGTTGCTCTGCAGGTAAAT GGG (reversed) Intergenic
No off target data available for this crispr