ID: 905002858

View in Genome Browser
Species Human (GRCh38)
Location 1:34686744-34686766
Sequence GTGACATACTCAAGGTCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905002858_905002860 4 Left 905002858 1:34686744-34686766 CCATGTGACCTTGAGTATGTCAC No data
Right 905002860 1:34686771-34686793 CTCCACACCACTGCATTAAATGG No data
905002858_905002864 19 Left 905002858 1:34686744-34686766 CCATGTGACCTTGAGTATGTCAC No data
Right 905002864 1:34686786-34686808 TTAAATGGGCATAATCAAACAGG No data
905002858_905002861 5 Left 905002858 1:34686744-34686766 CCATGTGACCTTGAGTATGTCAC No data
Right 905002861 1:34686772-34686794 TCCACACCACTGCATTAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905002858 Original CRISPR GTGACATACTCAAGGTCACA TGG (reversed) Intergenic
No off target data available for this crispr