ID: 905003216

View in Genome Browser
Species Human (GRCh38)
Location 1:34689696-34689718
Sequence CCTGAGAAGGAGCAATTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905003216_905003223 8 Left 905003216 1:34689696-34689718 CCCTACAATTGCTCCTTCTCAGG No data
Right 905003223 1:34689727-34689749 CCATCCACCTTCCTGCACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905003216 Original CRISPR CCTGAGAAGGAGCAATTGTA GGG (reversed) Intergenic
No off target data available for this crispr