ID: 905003221

View in Genome Browser
Species Human (GRCh38)
Location 1:34689722-34689744
Sequence GTGCAGGAAGGTGGATGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905003221_905003231 30 Left 905003221 1:34689722-34689744 CCATTCCATCCACCTTCCTGCAC No data
Right 905003231 1:34689775-34689797 CTCTGTAGCTGACTACGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905003221 Original CRISPR GTGCAGGAAGGTGGATGGAA TGG (reversed) Intergenic