ID: 905003224

View in Genome Browser
Species Human (GRCh38)
Location 1:34689731-34689753
Sequence GACACCTTAGTGCAGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905003224_905003233 28 Left 905003224 1:34689731-34689753 CCACCTTCCTGCACTAAGGTGTC No data
Right 905003233 1:34689782-34689804 GCTGACTACGTTAAGGGTGAAGG No data
905003224_905003231 21 Left 905003224 1:34689731-34689753 CCACCTTCCTGCACTAAGGTGTC No data
Right 905003231 1:34689775-34689797 CTCTGTAGCTGACTACGTTAAGG No data
905003224_905003232 22 Left 905003224 1:34689731-34689753 CCACCTTCCTGCACTAAGGTGTC No data
Right 905003232 1:34689776-34689798 TCTGTAGCTGACTACGTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905003224 Original CRISPR GACACCTTAGTGCAGGAAGG TGG (reversed) Intergenic