ID: 905003225

View in Genome Browser
Species Human (GRCh38)
Location 1:34689734-34689756
Sequence AGTGACACCTTAGTGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905003225_905003232 19 Left 905003225 1:34689734-34689756 CCTTCCTGCACTAAGGTGTCACT No data
Right 905003232 1:34689776-34689798 TCTGTAGCTGACTACGTTAAGGG No data
905003225_905003233 25 Left 905003225 1:34689734-34689756 CCTTCCTGCACTAAGGTGTCACT No data
Right 905003233 1:34689782-34689804 GCTGACTACGTTAAGGGTGAAGG No data
905003225_905003231 18 Left 905003225 1:34689734-34689756 CCTTCCTGCACTAAGGTGTCACT No data
Right 905003231 1:34689775-34689797 CTCTGTAGCTGACTACGTTAAGG No data
905003225_905003235 29 Left 905003225 1:34689734-34689756 CCTTCCTGCACTAAGGTGTCACT No data
Right 905003235 1:34689786-34689808 ACTACGTTAAGGGTGAAGGAGGG No data
905003225_905003234 28 Left 905003225 1:34689734-34689756 CCTTCCTGCACTAAGGTGTCACT No data
Right 905003234 1:34689785-34689807 GACTACGTTAAGGGTGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905003225 Original CRISPR AGTGACACCTTAGTGCAGGA AGG (reversed) Intergenic