ID: 905003226

View in Genome Browser
Species Human (GRCh38)
Location 1:34689738-34689760
Sequence GGTTAGTGACACCTTAGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905003226_905003233 21 Left 905003226 1:34689738-34689760 CCTGCACTAAGGTGTCACTAACC No data
Right 905003233 1:34689782-34689804 GCTGACTACGTTAAGGGTGAAGG No data
905003226_905003234 24 Left 905003226 1:34689738-34689760 CCTGCACTAAGGTGTCACTAACC No data
Right 905003234 1:34689785-34689807 GACTACGTTAAGGGTGAAGGAGG No data
905003226_905003232 15 Left 905003226 1:34689738-34689760 CCTGCACTAAGGTGTCACTAACC No data
Right 905003232 1:34689776-34689798 TCTGTAGCTGACTACGTTAAGGG No data
905003226_905003235 25 Left 905003226 1:34689738-34689760 CCTGCACTAAGGTGTCACTAACC No data
Right 905003235 1:34689786-34689808 ACTACGTTAAGGGTGAAGGAGGG No data
905003226_905003231 14 Left 905003226 1:34689738-34689760 CCTGCACTAAGGTGTCACTAACC No data
Right 905003231 1:34689775-34689797 CTCTGTAGCTGACTACGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905003226 Original CRISPR GGTTAGTGACACCTTAGTGC AGG (reversed) Intergenic