ID: 905003227

View in Genome Browser
Species Human (GRCh38)
Location 1:34689759-34689781
Sequence TACAGAGAGCAGGCAGGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905003227_905003235 4 Left 905003227 1:34689759-34689781 CCCAAGCCTGCCTGCTCTCTGTA No data
Right 905003235 1:34689786-34689808 ACTACGTTAAGGGTGAAGGAGGG No data
905003227_905003233 0 Left 905003227 1:34689759-34689781 CCCAAGCCTGCCTGCTCTCTGTA No data
Right 905003233 1:34689782-34689804 GCTGACTACGTTAAGGGTGAAGG No data
905003227_905003234 3 Left 905003227 1:34689759-34689781 CCCAAGCCTGCCTGCTCTCTGTA No data
Right 905003234 1:34689785-34689807 GACTACGTTAAGGGTGAAGGAGG No data
905003227_905003231 -7 Left 905003227 1:34689759-34689781 CCCAAGCCTGCCTGCTCTCTGTA No data
Right 905003231 1:34689775-34689797 CTCTGTAGCTGACTACGTTAAGG No data
905003227_905003232 -6 Left 905003227 1:34689759-34689781 CCCAAGCCTGCCTGCTCTCTGTA No data
Right 905003232 1:34689776-34689798 TCTGTAGCTGACTACGTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905003227 Original CRISPR TACAGAGAGCAGGCAGGCTT GGG (reversed) Intergenic
No off target data available for this crispr