ID: 905003228

View in Genome Browser
Species Human (GRCh38)
Location 1:34689760-34689782
Sequence CTACAGAGAGCAGGCAGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905003228_905003231 -8 Left 905003228 1:34689760-34689782 CCAAGCCTGCCTGCTCTCTGTAG No data
Right 905003231 1:34689775-34689797 CTCTGTAGCTGACTACGTTAAGG No data
905003228_905003233 -1 Left 905003228 1:34689760-34689782 CCAAGCCTGCCTGCTCTCTGTAG No data
Right 905003233 1:34689782-34689804 GCTGACTACGTTAAGGGTGAAGG No data
905003228_905003234 2 Left 905003228 1:34689760-34689782 CCAAGCCTGCCTGCTCTCTGTAG No data
Right 905003234 1:34689785-34689807 GACTACGTTAAGGGTGAAGGAGG No data
905003228_905003235 3 Left 905003228 1:34689760-34689782 CCAAGCCTGCCTGCTCTCTGTAG No data
Right 905003235 1:34689786-34689808 ACTACGTTAAGGGTGAAGGAGGG No data
905003228_905003232 -7 Left 905003228 1:34689760-34689782 CCAAGCCTGCCTGCTCTCTGTAG No data
Right 905003232 1:34689776-34689798 TCTGTAGCTGACTACGTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905003228 Original CRISPR CTACAGAGAGCAGGCAGGCT TGG (reversed) Intergenic