ID: 905003229

View in Genome Browser
Species Human (GRCh38)
Location 1:34689765-34689787
Sequence GTCAGCTACAGAGAGCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905003229_905003233 -6 Left 905003229 1:34689765-34689787 CCTGCCTGCTCTCTGTAGCTGAC No data
Right 905003233 1:34689782-34689804 GCTGACTACGTTAAGGGTGAAGG No data
905003229_905003235 -2 Left 905003229 1:34689765-34689787 CCTGCCTGCTCTCTGTAGCTGAC No data
Right 905003235 1:34689786-34689808 ACTACGTTAAGGGTGAAGGAGGG No data
905003229_905003234 -3 Left 905003229 1:34689765-34689787 CCTGCCTGCTCTCTGTAGCTGAC No data
Right 905003234 1:34689785-34689807 GACTACGTTAAGGGTGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905003229 Original CRISPR GTCAGCTACAGAGAGCAGGC AGG (reversed) Intergenic