ID: 905003230

View in Genome Browser
Species Human (GRCh38)
Location 1:34689769-34689791
Sequence CGTAGTCAGCTACAGAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905003230_905003233 -10 Left 905003230 1:34689769-34689791 CCTGCTCTCTGTAGCTGACTACG No data
Right 905003233 1:34689782-34689804 GCTGACTACGTTAAGGGTGAAGG No data
905003230_905003234 -7 Left 905003230 1:34689769-34689791 CCTGCTCTCTGTAGCTGACTACG No data
Right 905003234 1:34689785-34689807 GACTACGTTAAGGGTGAAGGAGG No data
905003230_905003235 -6 Left 905003230 1:34689769-34689791 CCTGCTCTCTGTAGCTGACTACG No data
Right 905003235 1:34689786-34689808 ACTACGTTAAGGGTGAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905003230 Original CRISPR CGTAGTCAGCTACAGAGAGC AGG (reversed) Intergenic