ID: 905003232

View in Genome Browser
Species Human (GRCh38)
Location 1:34689776-34689798
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905003228_905003232 -7 Left 905003228 1:34689760-34689782 CCAAGCCTGCCTGCTCTCTGTAG No data
Right 905003232 1:34689776-34689798 TCTGTAGCTGACTACGTTAAGGG No data
905003222_905003232 26 Left 905003222 1:34689727-34689749 CCATCCACCTTCCTGCACTAAGG No data
Right 905003232 1:34689776-34689798 TCTGTAGCTGACTACGTTAAGGG No data
905003224_905003232 22 Left 905003224 1:34689731-34689753 CCACCTTCCTGCACTAAGGTGTC No data
Right 905003232 1:34689776-34689798 TCTGTAGCTGACTACGTTAAGGG No data
905003225_905003232 19 Left 905003225 1:34689734-34689756 CCTTCCTGCACTAAGGTGTCACT No data
Right 905003232 1:34689776-34689798 TCTGTAGCTGACTACGTTAAGGG No data
905003227_905003232 -6 Left 905003227 1:34689759-34689781 CCCAAGCCTGCCTGCTCTCTGTA No data
Right 905003232 1:34689776-34689798 TCTGTAGCTGACTACGTTAAGGG No data
905003226_905003232 15 Left 905003226 1:34689738-34689760 CCTGCACTAAGGTGTCACTAACC No data
Right 905003232 1:34689776-34689798 TCTGTAGCTGACTACGTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type