ID: 905003233

View in Genome Browser
Species Human (GRCh38)
Location 1:34689782-34689804
Sequence GCTGACTACGTTAAGGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905003228_905003233 -1 Left 905003228 1:34689760-34689782 CCAAGCCTGCCTGCTCTCTGTAG No data
Right 905003233 1:34689782-34689804 GCTGACTACGTTAAGGGTGAAGG No data
905003225_905003233 25 Left 905003225 1:34689734-34689756 CCTTCCTGCACTAAGGTGTCACT No data
Right 905003233 1:34689782-34689804 GCTGACTACGTTAAGGGTGAAGG No data
905003224_905003233 28 Left 905003224 1:34689731-34689753 CCACCTTCCTGCACTAAGGTGTC No data
Right 905003233 1:34689782-34689804 GCTGACTACGTTAAGGGTGAAGG No data
905003229_905003233 -6 Left 905003229 1:34689765-34689787 CCTGCCTGCTCTCTGTAGCTGAC No data
Right 905003233 1:34689782-34689804 GCTGACTACGTTAAGGGTGAAGG No data
905003226_905003233 21 Left 905003226 1:34689738-34689760 CCTGCACTAAGGTGTCACTAACC No data
Right 905003233 1:34689782-34689804 GCTGACTACGTTAAGGGTGAAGG No data
905003230_905003233 -10 Left 905003230 1:34689769-34689791 CCTGCTCTCTGTAGCTGACTACG No data
Right 905003233 1:34689782-34689804 GCTGACTACGTTAAGGGTGAAGG No data
905003227_905003233 0 Left 905003227 1:34689759-34689781 CCCAAGCCTGCCTGCTCTCTGTA No data
Right 905003233 1:34689782-34689804 GCTGACTACGTTAAGGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905003233 Original CRISPR GCTGACTACGTTAAGGGTGA AGG Intergenic