ID: 905003234

View in Genome Browser
Species Human (GRCh38)
Location 1:34689785-34689807
Sequence GACTACGTTAAGGGTGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905003229_905003234 -3 Left 905003229 1:34689765-34689787 CCTGCCTGCTCTCTGTAGCTGAC No data
Right 905003234 1:34689785-34689807 GACTACGTTAAGGGTGAAGGAGG No data
905003230_905003234 -7 Left 905003230 1:34689769-34689791 CCTGCTCTCTGTAGCTGACTACG No data
Right 905003234 1:34689785-34689807 GACTACGTTAAGGGTGAAGGAGG No data
905003227_905003234 3 Left 905003227 1:34689759-34689781 CCCAAGCCTGCCTGCTCTCTGTA No data
Right 905003234 1:34689785-34689807 GACTACGTTAAGGGTGAAGGAGG No data
905003228_905003234 2 Left 905003228 1:34689760-34689782 CCAAGCCTGCCTGCTCTCTGTAG No data
Right 905003234 1:34689785-34689807 GACTACGTTAAGGGTGAAGGAGG No data
905003226_905003234 24 Left 905003226 1:34689738-34689760 CCTGCACTAAGGTGTCACTAACC No data
Right 905003234 1:34689785-34689807 GACTACGTTAAGGGTGAAGGAGG No data
905003225_905003234 28 Left 905003225 1:34689734-34689756 CCTTCCTGCACTAAGGTGTCACT No data
Right 905003234 1:34689785-34689807 GACTACGTTAAGGGTGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905003234 Original CRISPR GACTACGTTAAGGGTGAAGG AGG Intergenic