ID: 905003281

View in Genome Browser
Species Human (GRCh38)
Location 1:34690228-34690250
Sequence GGAGGTGCCCAACAGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905003281_905003289 5 Left 905003281 1:34690228-34690250 CCTTCCTTCTGTTGGGCACCTCC No data
Right 905003289 1:34690256-34690278 CCACACCTGGAGTTTAAAAGTGG No data
905003281_905003283 -8 Left 905003281 1:34690228-34690250 CCTTCCTTCTGTTGGGCACCTCC No data
Right 905003283 1:34690243-34690265 GCACCTCCTCGCCCCACACCTGG No data
905003281_905003291 12 Left 905003281 1:34690228-34690250 CCTTCCTTCTGTTGGGCACCTCC No data
Right 905003291 1:34690263-34690285 TGGAGTTTAAAAGTGGCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905003281 Original CRISPR GGAGGTGCCCAACAGAAGGA AGG (reversed) Intergenic
No off target data available for this crispr