ID: 905003282

View in Genome Browser
Species Human (GRCh38)
Location 1:34690232-34690254
Sequence GCGAGGAGGTGCCCAACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905003282_905003289 1 Left 905003282 1:34690232-34690254 CCTTCTGTTGGGCACCTCCTCGC No data
Right 905003289 1:34690256-34690278 CCACACCTGGAGTTTAAAAGTGG No data
905003282_905003291 8 Left 905003282 1:34690232-34690254 CCTTCTGTTGGGCACCTCCTCGC No data
Right 905003291 1:34690263-34690285 TGGAGTTTAAAAGTGGCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905003282 Original CRISPR GCGAGGAGGTGCCCAACAGA AGG (reversed) Intergenic
No off target data available for this crispr