ID: 905003289

View in Genome Browser
Species Human (GRCh38)
Location 1:34690256-34690278
Sequence CCACACCTGGAGTTTAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905003281_905003289 5 Left 905003281 1:34690228-34690250 CCTTCCTTCTGTTGGGCACCTCC No data
Right 905003289 1:34690256-34690278 CCACACCTGGAGTTTAAAAGTGG No data
905003282_905003289 1 Left 905003282 1:34690232-34690254 CCTTCTGTTGGGCACCTCCTCGC No data
Right 905003289 1:34690256-34690278 CCACACCTGGAGTTTAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905003289 Original CRISPR CCACACCTGGAGTTTAAAAG TGG Intergenic
No off target data available for this crispr