ID: 905003701

View in Genome Browser
Species Human (GRCh38)
Location 1:34693808-34693830
Sequence GAGCCCAAGGAGCCAGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905003699_905003701 -4 Left 905003699 1:34693789-34693811 CCTGGAGCAGAGACAAGGGGAGC No data
Right 905003701 1:34693808-34693830 GAGCCCAAGGAGCCAGAAGTTGG No data
905003695_905003701 1 Left 905003695 1:34693784-34693806 CCTAGCCTGGAGCAGAGACAAGG No data
Right 905003701 1:34693808-34693830 GAGCCCAAGGAGCCAGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905003701 Original CRISPR GAGCCCAAGGAGCCAGAAGT TGG Intergenic
No off target data available for this crispr