ID: 905004411

View in Genome Browser
Species Human (GRCh38)
Location 1:34698359-34698381
Sequence CTCTGACACCTGTATCTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905004411_905004417 21 Left 905004411 1:34698359-34698381 CCTTCTAGATACAGGTGTCAGAG No data
Right 905004417 1:34698403-34698425 GTACAGATGAGAAAACTGAGAGG No data
905004411_905004419 29 Left 905004411 1:34698359-34698381 CCTTCTAGATACAGGTGTCAGAG No data
Right 905004419 1:34698411-34698433 GAGAAAACTGAGAGGGTCGCAGG No data
905004411_905004418 22 Left 905004411 1:34698359-34698381 CCTTCTAGATACAGGTGTCAGAG No data
Right 905004418 1:34698404-34698426 TACAGATGAGAAAACTGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905004411 Original CRISPR CTCTGACACCTGTATCTAGA AGG (reversed) Intergenic
No off target data available for this crispr