ID: 905004584

View in Genome Browser
Species Human (GRCh38)
Location 1:34699479-34699501
Sequence GGGGTGTTAATGAACCCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905004584_905004596 14 Left 905004584 1:34699479-34699501 CCAACAGGGTTCATTAACACCCC No data
Right 905004596 1:34699516-34699538 GAGAGGAAGGAGGTCTCCAGTGG No data
905004584_905004590 1 Left 905004584 1:34699479-34699501 CCAACAGGGTTCATTAACACCCC No data
Right 905004590 1:34699503-34699525 ACCCCCATCAGATGAGAGGAAGG No data
905004584_905004594 4 Left 905004584 1:34699479-34699501 CCAACAGGGTTCATTAACACCCC No data
Right 905004594 1:34699506-34699528 CCCATCAGATGAGAGGAAGGAGG No data
905004584_905004587 -3 Left 905004584 1:34699479-34699501 CCAACAGGGTTCATTAACACCCC No data
Right 905004587 1:34699499-34699521 CCCCACCCCCATCAGATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905004584 Original CRISPR GGGGTGTTAATGAACCCTGT TGG (reversed) Intergenic
No off target data available for this crispr