ID: 905005507

View in Genome Browser
Species Human (GRCh38)
Location 1:34706475-34706497
Sequence CAGTGAATCCAGAGGCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905005504_905005507 14 Left 905005504 1:34706438-34706460 CCAAAGGAGTTAAGGAGAGCAAA No data
Right 905005507 1:34706475-34706497 CAGTGAATCCAGAGGCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905005507 Original CRISPR CAGTGAATCCAGAGGCAAGA AGG Intergenic
No off target data available for this crispr