ID: 905007458

View in Genome Browser
Species Human (GRCh38)
Location 1:34721333-34721355
Sequence GCTGGAAGGCAGAGGCTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 666
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 616}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905007458_905007465 13 Left 905007458 1:34721333-34721355 CCCTCTAGCCTCTGCCTTCCAGC 0: 1
1: 0
2: 2
3: 47
4: 616
Right 905007465 1:34721369-34721391 TGCACACATACACACACTCCTGG 0: 1
1: 0
2: 21
3: 162
4: 1271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905007458 Original CRISPR GCTGGAAGGCAGAGGCTAGA GGG (reversed) Intronic
900127791 1:1076043-1076065 GCTGGGAGGCTGAGGCTATGGGG + Intergenic
900127886 1:1076341-1076363 GCTGGGAGGCTGAGGCTATGGGG + Intergenic
900182601 1:1318919-1318941 GCAGGGAGGCAGGGGCTGGAGGG - Intronic
900333055 1:2146157-2146179 GCTAGAAGGCAGAGGTGAGCAGG - Intronic
900343806 1:2201314-2201336 GCTCGAAGGCACAGCCTGGAAGG + Intronic
900399012 1:2465357-2465379 GGTGGAGGGCAGAGGGCAGAGGG - Intronic
900619761 1:3581359-3581381 GCTGGAGGGAAGAGGCTGGTAGG - Intronic
901459652 1:9383996-9384018 CCTGGGAGGCAGAGGCTGAAAGG - Intergenic
901475179 1:9484599-9484621 TTTGGGAGGCTGAGGCTAGAGGG + Intergenic
901712844 1:11129265-11129287 GCTGTACGGCAGAGGCAACAGGG + Intronic
902300455 1:15498795-15498817 GCTGGAATGCAGTGGCGCGATGG + Intronic
902353988 1:15882771-15882793 GATGAAAGGCACAGCCTAGAGGG + Intronic
902863579 1:19262729-19262751 TCTGGGAGGTAGAGGCTACAGGG + Intergenic
902886348 1:19407614-19407636 TCTGGAAGGCTGAGGATTGAGGG + Intronic
902937817 1:19777221-19777243 GCAGGAAGGAAGAGGGCAGAGGG - Intronic
903369901 1:22828473-22828495 TCTGGCAGGAAGAGGCCAGAGGG + Intronic
903670294 1:25031338-25031360 GCTGGAGGGTGGAGGCTGGAGGG + Intergenic
903749601 1:25612814-25612836 CCTGGGAGGTAGAGGCTACAGGG - Intergenic
903888510 1:26554987-26555009 TCTGGTTGGCAGAGGCAAGAGGG + Intronic
904142846 1:28367583-28367605 TCTGGAAGGCCAAGGCTGGAGGG - Intergenic
904591389 1:31617524-31617546 GCTTGAAGTGGGAGGCTAGAAGG + Intergenic
904813416 1:33178938-33178960 GCTCTGAAGCAGAGGCTAGAAGG + Intronic
905007458 1:34721333-34721355 GCTGGAAGGCAGAGGCTAGAGGG - Intronic
905269680 1:36779336-36779358 GTTGGAAGTTAGAGCCTAGATGG - Intergenic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
906747245 1:48230702-48230724 GCAGGTAGGCAGAGGGAAGAGGG + Exonic
908587121 1:65582046-65582068 GCGGACAGACAGAGGCTAGAAGG - Intronic
908658686 1:66415309-66415331 ACTGGAAGGACGATGCTAGATGG - Intergenic
908780358 1:67685205-67685227 GCTGGTAGGCAGTGGCTGGGAGG + Exonic
909370179 1:74874403-74874425 GCTGGAAGAGAGAGATTAGATGG + Intergenic
909931443 1:81503641-81503663 GGGGGCAGGGAGAGGCTAGAGGG + Intronic
910808020 1:91207980-91208002 GTTGGGAGACAGAAGCTAGATGG + Intergenic
911216757 1:95203332-95203354 ACTGGGAGGCAGAGGCTGCAGGG - Intronic
911607729 1:99927577-99927599 TTTGGGAGGCTGAGGCTAGAGGG - Intergenic
912691902 1:111810961-111810983 GGTGACAGGCAGAGGCTAGAGGG - Intronic
912861427 1:113217189-113217211 GCAGGAAGACAGAGCCAAGAGGG - Intergenic
913282827 1:117201873-117201895 GAAAGAAGGAAGAGGCTAGAAGG + Intronic
914680303 1:149934228-149934250 GCAGGCAGCCAGAGGCTGGAGGG - Exonic
915114904 1:153591265-153591287 GCTGGAATGCAGTGGCGTGATGG - Intergenic
915519968 1:156436333-156436355 GCTGGGAGGCGGCGGCTAGGAGG - Intergenic
915579911 1:156807376-156807398 CCTAGGAGGCAGAGGGTAGAGGG - Intronic
915601253 1:156924402-156924424 TCTGGAAGGCAGAGGTGAGGAGG - Exonic
915849165 1:159302567-159302589 GCTAGAAAGCAGAGGCAAGTGGG + Intronic
916945240 1:169719703-169719725 TCTGGAAGGTAAAGGCAAGATGG - Intronic
917645636 1:177026153-177026175 GCTGGAAAGGAGAGACTTGAGGG + Intronic
917863085 1:179166699-179166721 CCTGGAAGGCAGAGGTTGCAGGG + Intronic
918082823 1:181220844-181220866 GCTGGTAGGCAGGGGCCAGAGGG - Intergenic
918444911 1:184608138-184608160 GAAGGAGGGCAGAGGCTAGCAGG + Intronic
918521658 1:185421350-185421372 GAAGGAAGGCAGAGGAGAGAGGG - Intergenic
919630364 1:199954871-199954893 GCTGGAGAGCAGAGGGAAGAGGG - Intergenic
920993352 1:210961762-210961784 CCTGGGAGGCAGAGGTTACAGGG + Intronic
921332206 1:214050638-214050660 GCTGGAAGGCAGAGGAAATCTGG + Intergenic
922425028 1:225484579-225484601 GCTGGGAGGGAGTGGCTGGAAGG + Intergenic
922752468 1:228077018-228077040 GCTTCCAGGCAGAGGCTAGCAGG - Intergenic
923035902 1:230285018-230285040 GGTGGAAGGCAGAGGGGAGCAGG + Intergenic
923551220 1:234965454-234965476 GCTGGAAGGCTCAGGATAGCAGG - Intergenic
923981657 1:239330871-239330893 GCTGAAAAGCAGTGGCAAGAGGG - Intergenic
924212284 1:241782872-241782894 GCTGGAAGGTAAAAGCTAAAGGG - Intronic
924380643 1:243460851-243460873 GCTGGGAGGCACAGGCTAAGAGG - Intronic
924671070 1:246125971-246125993 ATTGGAAGGAAGAGACTAGAGGG + Intronic
1063009884 10:2011729-2011751 ACTGGAAGGCTGAGGGGAGATGG - Intergenic
1064227846 10:13503323-13503345 GCTGAAAGGAAGAGGGCAGAAGG + Intronic
1065111528 10:22444705-22444727 GCTGGAACGGAGAGGGAAGAAGG + Intronic
1065181567 10:23131343-23131365 GTTGGAGGGCAGAGGGTGGAAGG + Intergenic
1065520869 10:26570580-26570602 CTTGGAAGGCTGAGGCAAGAGGG - Intergenic
1065918509 10:30371388-30371410 CCTGGAAGGCAGAGGCTGCAGGG + Intronic
1066658943 10:37721010-37721032 GGTGGGAAGCAGAGGCTGGATGG - Intergenic
1067227307 10:44384580-44384602 GCGGGAAGGCAGTGGGTGGAGGG + Intronic
1067288701 10:44926265-44926287 GCTGGAAAGCAGTGGGTAGCAGG + Intronic
1067523642 10:47026010-47026032 GCAGGGAGGCAGAGGGCAGATGG - Intergenic
1067775476 10:49161910-49161932 GCTGGGAGGCAATGGCTGGATGG - Intronic
1068425577 10:56859334-56859356 GCTGATGGGCAGAGGCTGGAAGG - Intergenic
1069876008 10:71563277-71563299 GCTGGAATGCAGGAGCTGGAAGG - Intronic
1071204147 10:83254742-83254764 GATGGAAGGCAAAGGGTAGCAGG + Intergenic
1071514954 10:86291184-86291206 GGTGGAAAGCAGAGCCCAGAGGG + Intronic
1072422160 10:95297965-95297987 AGTTGAAGGCAGAGGCTAGGTGG - Intergenic
1072732966 10:97860426-97860448 GCTGGGAGACAGAGGCTGCAGGG - Intronic
1072784906 10:98272874-98272896 GCTGGCAGGGAGAGGGTTGAAGG + Intergenic
1072801364 10:98394466-98394488 GCTAGAAGCTAGAAGCTAGAAGG - Intronic
1072825807 10:98605098-98605120 GCTGGAAGGGAGGAGCTAAAGGG - Intronic
1072913945 10:99525991-99526013 GCTGGAAGGTAAAAGGTAGAGGG + Intergenic
1073001694 10:100290524-100290546 TCAGGAAGTCAGAGGTTAGAGGG + Intronic
1073026501 10:100490722-100490744 GCTCAAAGGCAAAGGCTGGATGG + Exonic
1076098449 10:127753602-127753624 ACTGGAGGGAAGGGGCTAGAAGG + Intergenic
1076101069 10:127778952-127778974 GCTGGGAGGCAGAGGTTGAAGGG - Intergenic
1076157685 10:128216094-128216116 GGTGGAGGGCAGAGGGCAGAGGG + Intergenic
1077021346 11:418453-418475 CATGGAAGGCAGAGGCTGGGTGG - Exonic
1077669987 11:4148333-4148355 CCTGGGAGGCTGAGGCAAGAGGG - Intergenic
1078557330 11:12340051-12340073 TCTGGAAGGTAGAGCCAAGATGG - Intronic
1079002598 11:16770363-16770385 AATGGAAGGCAGAGGGTGGAGGG + Intergenic
1079043790 11:17082049-17082071 TTTGGAAGGCTGAGGCTGGAGGG - Intronic
1079803934 11:24905450-24905472 CCTGGAAGGCAGAGGTTGCAGGG + Intronic
1080943254 11:36943059-36943081 GCTGGAAGGCAGAGTGATGAAGG + Intergenic
1081300143 11:41441302-41441324 GGTGGAAGGTAGAGGCAAAATGG + Intronic
1081869585 11:46377232-46377254 GCTGAAAGCCAGGGGCTGGAGGG - Intronic
1082812864 11:57489170-57489192 CCTGGAAGGCAGGTGCTGGATGG + Intronic
1083258513 11:61510607-61510629 GCTGGAAGGCTCAGGCTATGGGG - Exonic
1083749784 11:64754616-64754638 GCAGGCAGGCCGAGGCTGGAGGG + Intronic
1083778064 11:64903767-64903789 GCAGGAACGCTGAGGCTGGAGGG - Intronic
1084321048 11:68373533-68373555 GCTGGGCGGCAGAGGCTCGTGGG - Intronic
1084327718 11:68411414-68411436 GCTGGAAGGCACAAGGGAGAAGG - Exonic
1084394147 11:68897894-68897916 CCTGGGAGACAGAAGCTAGAGGG - Intronic
1084653489 11:70502286-70502308 GCTGGAGGGCAGAGGAGAGATGG + Exonic
1084777950 11:71389545-71389567 GTTGGAAGCCAGAGGCTTGGCGG + Intergenic
1084954193 11:72682915-72682937 GCTGGGGGGCAGAGGGGAGAGGG - Intergenic
1085483408 11:76841607-76841629 GCTGGAAGGGAGAGACTGGTGGG - Intergenic
1085681085 11:78575450-78575472 GTTGGAGGGCAGAGGGAAGAGGG - Intergenic
1085705994 11:78787124-78787146 GATGGGAGGCAGTGGCCAGAGGG + Intronic
1085998803 11:81954296-81954318 GTTGGGAGACAGAGGCTGGATGG - Intergenic
1086476296 11:87178499-87178521 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1086694834 11:89830721-89830743 GGTAGAAGGCAGAGGGTATAGGG + Intergenic
1086711314 11:90013776-90013798 GGTAGAAGGCAGAGGGTATAGGG - Intergenic
1087332625 11:96800149-96800171 GGTGGAGGGTAGAGGGTAGAAGG - Intergenic
1087533758 11:99416738-99416760 GCAAGGAGGCAGAGGCTGGAGGG + Intronic
1087785840 11:102353375-102353397 GCTGGAGTGCAGTGGCAAGATGG + Intronic
1087894874 11:103576131-103576153 GTTGGAAGACGGAAGCTAGATGG - Intergenic
1088108207 11:106229064-106229086 ATTGGAAGGCAGAGGCTGAATGG - Intergenic
1088303565 11:108384695-108384717 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1088710876 11:112507433-112507455 GGTGGAAGGCAGAGGCAGAATGG - Intergenic
1089127758 11:116189409-116189431 GCTGGAAAGGAGAGGCTGGATGG - Intergenic
1089153406 11:116382724-116382746 GCTGGCAGGGTGAGTCTAGACGG + Intergenic
1089499072 11:118922312-118922334 GCTGGAAGGCCAGGGCTAGGAGG - Intronic
1089528730 11:119113202-119113224 GCTGGAGGGCTGAGGGTAGCAGG - Intronic
1089776272 11:120838860-120838882 CCTGGGAGGCAGAGGTTGGAAGG - Intronic
1090610883 11:128469350-128469372 GCTGGAAGGGAGGGGCCAGCAGG - Intronic
1090675064 11:128984297-128984319 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1091441061 12:512027-512049 GGTGGAAGGCAGAAGGTAGAAGG - Intronic
1091441177 12:512496-512518 GGTGGAAGGCAGAAGGTAGAAGG - Intronic
1091532311 12:1371197-1371219 GTTGCAAGGCAGAGGAGAGAGGG - Intronic
1091623948 12:2108569-2108591 GCTGGACTGCAGGGGCCAGAGGG - Intronic
1091700142 12:2653782-2653804 GCTGGAGTGCAGAGGCCAGCTGG - Intronic
1091772517 12:3162206-3162228 GGTGGAAGGCAGAAGCGAGTCGG - Intronic
1092408209 12:8235274-8235296 GCTGGAAGGCAGAGAGCTGATGG + Intergenic
1093107327 12:15104360-15104382 CCTGGGAGGCAGAGGCTGCAGGG - Intergenic
1094014274 12:25845996-25846018 GCTGGAATGCAGTGGCACGATGG + Intergenic
1094110661 12:26858811-26858833 CCTGGAGGTCAGAGGCTAAATGG - Intergenic
1094161509 12:27395839-27395861 GTTGGGAGGCAGAGTCTAGTGGG - Intronic
1094293413 12:28877206-28877228 GTTTGAAGGCAGAAGCCAGATGG - Intergenic
1094365576 12:29676603-29676625 GTTTGAAGGCAGAGTGTAGATGG - Intronic
1095417275 12:41990579-41990601 CCTGGGAGGCTGAGGCCAGAGGG - Intergenic
1095691673 12:45096282-45096304 CCTGGGAGGCGGAGGCAAGATGG + Intergenic
1095943425 12:47740503-47740525 GTGGGAAGGCAGAGGCTCCAGGG + Intronic
1096183443 12:49563851-49563873 GGTGGTAGGCAGTGGCTAGGGGG - Intronic
1096724299 12:53548738-53548760 TTTGGAAGGCTGAGGCAAGAGGG + Intronic
1097189885 12:57214609-57214631 GCTGGCTGGCAGAGGGTGGAGGG - Intergenic
1097338052 12:58406745-58406767 GCATAAAAGCAGAGGCTAGAGGG + Intergenic
1099649060 12:85401090-85401112 ACTGGAAGGCTGAGGATGGAAGG + Intergenic
1101119699 12:101565907-101565929 CCTGGGAGGCGGAGGCTACAGGG + Intergenic
1101227608 12:102705465-102705487 GATGGAAAGCAGATGGTAGAGGG - Intergenic
1101807288 12:108075475-108075497 GCTGGAGTGCAGTGGCGAGAGGG + Intergenic
1101856288 12:108446112-108446134 TCTGGGAGGCAGAGGTTACACGG - Intergenic
1101892047 12:108725909-108725931 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1102243122 12:111337957-111337979 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1102484617 12:113247382-113247404 GCGGGAAGGCAGGGGGCAGAAGG - Intronic
1102571722 12:113830846-113830868 GTTGGAAAGCAGAGGCTGAAAGG + Intronic
1102960704 12:117091665-117091687 GCTGGGAGGAAGAGGCAGGAGGG - Intronic
1104449930 12:128860798-128860820 GTTGGAAGGAAGAGGTCAGAAGG + Intronic
1104475683 12:129068768-129068790 GAGGGGAGGCAGAGGCGAGAAGG - Intergenic
1104953238 12:132451676-132451698 GTTGGAAGGCAGAGGGCGGAGGG + Intergenic
1106019396 13:25900113-25900135 GCTGGGAGGCAGAGCTGAGAGGG + Intronic
1106106077 13:26734537-26734559 GGGGGAAGCCAGGGGCTAGAAGG + Intergenic
1107700386 13:43041266-43041288 GCTTGAAGGCAAATGCTTGAAGG - Intronic
1107939554 13:45371794-45371816 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1108112301 13:47088198-47088220 GCTGGAAGCAAGAAGCAAGAAGG + Intergenic
1108505111 13:51106219-51106241 GCTGAAAGGAAGTGGCCAGAAGG - Intergenic
1108609630 13:52071400-52071422 GCTAAGAGGCAGGGGCTAGAGGG - Intronic
1108635990 13:52334505-52334527 ACTGGAAGCCAGAGCCTAAATGG - Intergenic
1108651820 13:52488743-52488765 ACTGGAAGCCAGAGCCTAAATGG + Intergenic
1108939762 13:55938251-55938273 GCTGGAAGGCAGCAGCTCAAAGG + Intergenic
1109081348 13:57905299-57905321 ACTGGAGGGCAGAGGGTGGAAGG + Intergenic
1109198626 13:59407002-59407024 ACTTGAGGGCAGAGGGTAGAAGG - Intergenic
1109485366 13:63011142-63011164 GATGGAAGGCACAGGCAAAAAGG + Intergenic
1111316468 13:86567341-86567363 GCCGGAAGCCAGGGGCTATATGG - Intergenic
1111802633 13:92998971-92998993 GTTGGGAGGCTGAGGCTGGAGGG + Intergenic
1112735605 13:102413149-102413171 GCTGGAGAACAGTGGCTAGAAGG - Intergenic
1112802195 13:103124745-103124767 GGTGGGAGGCAGTGGGTAGAAGG + Intergenic
1113449124 13:110393801-110393823 TCTGGGAGGCAGAGGTTACAGGG + Intronic
1113935702 13:113994552-113994574 TCTGGGAGGCCGAGGCAAGAAGG + Intronic
1114290816 14:21286916-21286938 TTTGGGAGGCAGAGGCTGGAAGG + Intergenic
1114905700 14:27123261-27123283 GCTAGAAGGCTGCTGCTAGAAGG - Intergenic
1115529401 14:34313164-34313186 GCAGGAAGACAGAGTCTAAATGG + Intronic
1115857987 14:37651842-37651864 GGTGGGATGCAGAGTCTAGAGGG + Intronic
1115877469 14:37876562-37876584 GCTGGATGGCAGAGAGTGGAGGG - Intronic
1116050562 14:39797688-39797710 CCTGGAAGGCAGAGGTTGCATGG - Intergenic
1116649918 14:47576991-47577013 TTTGGGAGGCAGAGGCAAGAGGG - Intronic
1117605581 14:57425218-57425240 ACTGTAAGCCAGAGGCTAGAAGG + Intergenic
1117776658 14:59190104-59190126 GCTGGGAGGGAGTGGCTAGTGGG + Intronic
1119073253 14:71608842-71608864 GCTGGAATGCAGTGGCACGATGG - Intronic
1119335342 14:73828883-73828905 GCTGGAGTGCAGAGGCATGATGG + Intergenic
1119370638 14:74138720-74138742 GCTGGAGTGCAGAGGATAGGGGG - Intronic
1119557765 14:75566837-75566859 GGTCGAAGGCAGAGGCCTGAAGG + Intergenic
1119727699 14:76932072-76932094 GCTGGAAGACTGAAGCTAGAGGG - Intergenic
1119842855 14:77806379-77806401 GTTGGAAGTCAGAAGCAAGATGG + Intronic
1119901481 14:78264255-78264277 GTTGGGAAGCAGAAGCTAGAAGG - Intronic
1120153227 14:81061633-81061655 GCTTGAAGGCAGAGGGTGGGAGG + Intronic
1120601637 14:86517473-86517495 GTTGGGAGGCCGAGGCTGGAGGG + Intergenic
1121094081 14:91203750-91203772 ACTGGGAGGCAGAGGTTATAGGG - Intronic
1121100091 14:91244587-91244609 GTTTGAAGGCAGAGCCTAGCTGG - Intronic
1121139433 14:91528302-91528324 GCTGAGAGGCTGAGGCAAGAGGG - Intergenic
1121155779 14:91682649-91682671 GTTGGCAGGCAGAGTCTAGATGG - Intronic
1121242777 14:92441910-92441932 GCTGGAGGGCAGATGGCAGAGGG + Intronic
1121484797 14:94306322-94306344 GCTGGAGGGCAGGAGCTGGAGGG - Intronic
1121729699 14:96177881-96177903 GCTTGAAGGCAGAGTTTAGGAGG + Intergenic
1121752244 14:96366826-96366848 GCTGTATGCCAGAGGCTAAATGG + Intronic
1122127693 14:99588011-99588033 GCTGGCAGGCACAGGCGAGCTGG - Intronic
1122292879 14:100688828-100688850 GGAGGCAGGCAGAGGCTGGACGG + Intergenic
1122540239 14:102493906-102493928 GTTGGATGGCAGATGCCAGAAGG - Intronic
1122549758 14:102543597-102543619 GGCTGAGGGCAGAGGCTAGAGGG - Intergenic
1122580579 14:102769162-102769184 ACTGGAAGGAAGAGGGGAGAAGG + Intergenic
1122929043 14:104925057-104925079 GCTGGGAGGCTGAGGCCATAGGG - Intronic
1202904333 14_GL000194v1_random:59780-59802 GCTGCCTGGCAGAGGCTGGATGG + Intergenic
1125620883 15:41060651-41060673 GTTGGAAGTCAAAGGCTACAAGG + Intronic
1125783849 15:42297403-42297425 CTTGGGAGGCTGAGGCTAGAGGG - Intronic
1125999565 15:44195762-44195784 GCTGGAGCACAGAGGCCAGACGG - Intergenic
1126503416 15:49374617-49374639 CCTGGGAGGCGGAGCCTAGATGG - Intronic
1126890963 15:53203746-53203768 TCTGGAGGTCAGAGGCCAGAGGG - Intergenic
1127138930 15:55953960-55953982 GCTGGGAGGCCGAGGCAGGAGGG - Intronic
1127441686 15:59015512-59015534 GCTGAAGGGAACAGGCTAGAGGG - Intronic
1128328555 15:66741075-66741097 GCCGGAAGGCAGAGGGATGAGGG - Intronic
1128705969 15:69837667-69837689 GCTGTGAGGCAGAGGCAAAAGGG + Intergenic
1129191908 15:73942259-73942281 GCAGGAAGGGATGGGCTAGAAGG - Intronic
1129294396 15:74591929-74591951 CCTGGAAGGCAGAACCTGGAGGG - Intronic
1129295106 15:74595946-74595968 GGGGGCAGGGAGAGGCTAGAGGG + Exonic
1129430606 15:75498637-75498659 CCTGGGAGGCAGAGGTTACAGGG + Intronic
1129607919 15:77033777-77033799 CCTGGGAGGCAGAGGCTCGTGGG + Intronic
1129878521 15:78992543-78992565 GCTGGAAGGCGGTGGGTAAAGGG + Intronic
1130048933 15:80467493-80467515 GCTGGAATGCAGACTCTAGGTGG + Intronic
1130180636 15:81624309-81624331 CTTGGAAGGCTGAGGCGAGAAGG - Intergenic
1131077761 15:89506544-89506566 GCTGGAAGGCAGTTGACAGAAGG - Intergenic
1131172080 15:90185496-90185518 GCTAGAAGGAGAAGGCTAGAAGG + Intronic
1131688109 15:94793204-94793226 CCTGGAGAGCAGAGGCAAGAGGG - Intergenic
1131833512 15:96368912-96368934 GCTGGATGGCGGAGGGAAGACGG + Intergenic
1132347319 15:101116177-101116199 GTTGGCAGGAAGAGGCTGGAGGG - Intergenic
1132423847 15:101697298-101697320 GGTGGTGGGCAGAAGCTAGAAGG + Intronic
1132996911 16:2828177-2828199 GCTGGATGGCAGAGTCAGGAAGG - Intergenic
1133190936 16:4133326-4133348 CCTGGGAGGCAGAGGTTACAGGG - Intergenic
1133287334 16:4696749-4696771 GCCGGCAGACAGAGGCAAGACGG - Exonic
1133349165 16:5090105-5090127 GCTGGAAGGCAGAGAGCTGATGG + Exonic
1133692786 16:8232724-8232746 GGTGGGTGGCAGAGGGTAGAGGG - Intergenic
1134089388 16:11383588-11383610 CCTGGAAGGCAGATGCCAGACGG + Intronic
1134273399 16:12754629-12754651 GCTGACAGGCAGAGGCCAAAAGG + Intronic
1134389803 16:13808865-13808887 GTTGGAAGGCAGAGGGCACATGG - Intergenic
1135899238 16:26441514-26441536 GCTGGAAGGCAGAAGGGAGATGG - Intergenic
1136251359 16:29007603-29007625 CCTGGGAGGCGGAGCCTAGATGG + Intergenic
1136372528 16:29845309-29845331 CATGGAAGGGGGAGGCTAGAAGG - Intronic
1136627764 16:31472349-31472371 GCAGGAAGGGAGAGGCAGGAAGG - Intronic
1137065554 16:35838438-35838460 TCTGAAAGGCAGAGGCAGGATGG + Intergenic
1137654165 16:50146006-50146028 GCTGGAATGCAGTGGCATGATGG - Intergenic
1137767805 16:50991401-50991423 GCTGGCAGGCAGAGGCTGCAGGG - Intergenic
1137923899 16:52521341-52521363 GCTGGTTGGCATAGGATAGATGG - Intronic
1138580724 16:57939130-57939152 GCTGGCAGGGAGAGGCTGGAAGG + Intronic
1139448546 16:67013577-67013599 GCTGGATGACAGAGGCGGGAGGG + Intergenic
1140021139 16:71239904-71239926 ACAGGAAGGCAGAGGCCAGTGGG + Intergenic
1141328232 16:83082594-83082616 GCTGGAATGCAGTGGCACGATGG - Intronic
1141923337 16:87151151-87151173 GCTGCAAGGAAGAGACTATACGG + Intronic
1142008260 16:87700639-87700661 GCTGGAGGGCAGAGGGAGGAGGG + Intronic
1142779770 17:2172501-2172523 GCTGGATGTCAGCGGCTAAAAGG + Intronic
1142982932 17:3681779-3681801 GGTGGGAGGCAGGGGCTGGAGGG - Intronic
1143392510 17:6568186-6568208 GCAGGAAGGCAAAGGCAAAAAGG + Intergenic
1143934913 17:10473588-10473610 GCTAGAATCCAGAGGCTAAATGG + Intergenic
1144957253 17:19025089-19025111 GCTGGAAGGCAGGGCACAGACGG - Intronic
1145297328 17:21601816-21601838 GCTGGGAGCCAGAGGAGAGATGG + Intergenic
1145366629 17:22271085-22271107 GCTGGGAGCCAGAGGAGAGATGG - Intergenic
1146471412 17:33127932-33127954 GCAGGAGAGAAGAGGCTAGAAGG - Intronic
1146795043 17:35774725-35774747 GCTGGGAGGCAGAGGTTGGGTGG - Intronic
1146836901 17:36118257-36118279 GCTGGAAGGCAGGGTCTGCAGGG + Intergenic
1147002492 17:37373930-37373952 GCAGGCAGCCAGAGGCAAGAGGG + Intronic
1147535878 17:41323192-41323214 GGTTGAAGGCAGAGGACAGAGGG - Intergenic
1147599939 17:41739288-41739310 TTTGGGAGGCCGAGGCTAGATGG - Intergenic
1147619638 17:41856942-41856964 TCTGGGAGGCAGAGGTTATAGGG + Intronic
1147911017 17:43856307-43856329 GCTGGATGGCAAAGACTAAAAGG + Intronic
1148121690 17:45216420-45216442 GCTGGGAGGGAGAGGGTAAAAGG - Intergenic
1148128649 17:45249349-45249371 CCTGGAAGGCTGAGGGTAGAGGG + Intergenic
1148497344 17:48060715-48060737 GTTGGTAGGCAGAGGCCCGAGGG - Exonic
1148682149 17:49480458-49480480 GCTGGGAAGCAGAGGGGAGAAGG + Intergenic
1148772977 17:50077514-50077536 GCAGGCAGGCAGAGGCTGGAAGG - Intronic
1149040376 17:52181521-52181543 GCATGGAGGCAGAGGCAAGATGG + Intergenic
1149548360 17:57521219-57521241 GCAGGAAGGCAGCGGCTGGCAGG + Intronic
1149594522 17:57856575-57856597 GCTGGAGTGCAGCGGTTAGATGG + Intergenic
1149628196 17:58095419-58095441 GCTGGAAGACAGAGGTGGGAGGG - Exonic
1149632283 17:58136287-58136309 GTTGGAAGGCAGAGGCAGAAGGG - Intergenic
1150274912 17:63890579-63890601 GCTGGAGGGCAGTGGCATGATGG + Intergenic
1150277043 17:63905345-63905367 GCTGGAGTGCAGTGGCTTGATGG + Intergenic
1150317694 17:64183500-64183522 CCTGGGAGGCAGAGGTTACAGGG - Intronic
1150677099 17:67254108-67254130 CCTGGAAGGCAGAGGTTGCAGGG - Intergenic
1150702599 17:67460790-67460812 GCTGGAATGCAGCGGCGCGACGG + Intronic
1150823974 17:68457881-68457903 GCTGGGAGGGAGAGGGAAGAAGG + Intergenic
1151405723 17:73884917-73884939 ACTGGAAGGCAGAGGGTAAGGGG + Intergenic
1152293133 17:79452115-79452137 GCTGGAAGGCATGGGGCAGACGG + Intronic
1152516353 17:80827012-80827034 GCGGGAAGGAAGAGGCGAGCAGG + Intronic
1152583393 17:81178817-81178839 GCTGGAAGCCTGAGGTCAGAGGG - Intergenic
1152673380 17:81623116-81623138 GCTGGGAGGCAGAGGTTGCAGGG + Intronic
1152884408 17:82840892-82840914 GCTGCAGGGCAGAGGCTGCAGGG + Intronic
1153841576 18:9012748-9012770 GGTGGAAGGCAAAGGCAAGCTGG + Intergenic
1153842461 18:9019119-9019141 ACTTGAAGGCAGAGGGTGGAAGG - Intergenic
1154005184 18:10521277-10521299 TCTGGGAGGCTGAGGCAAGAGGG + Intergenic
1155029096 18:21968651-21968673 GCTGGGACGCAGAGGCAATACGG - Intergenic
1155524900 18:26706158-26706180 GCTGCAGGGCAGAGGCAACATGG - Intergenic
1156154175 18:34281764-34281786 GCTGGCAGTCTGAGCCTAGAGGG + Intergenic
1156475124 18:37401089-37401111 GCTGTGAGGCAGGGCCTAGATGG + Intronic
1157288385 18:46392899-46392921 GCTGGAATCCAGAGGGTAGCAGG - Intronic
1158932684 18:62336455-62336477 GCATGGAGGCAGAGCCTAGAGGG + Intronic
1158934127 18:62349041-62349063 GATGGAAGGCAGAGGGGAGAGGG + Intronic
1159081419 18:63739980-63740002 TCTGGAAGACACAGGCTATAAGG - Intergenic
1159266256 18:66083859-66083881 TCTGGGAGGCAGAGGTCAGAAGG - Intergenic
1160272735 18:77402731-77402753 TCTGGATGGCAGAGTCTATATGG + Intergenic
1160977470 19:1800449-1800471 TCTGGAAGGCAGACGCGACAGGG + Exonic
1162522483 19:11190002-11190024 ACTGGAGGGCACAGGCTGGAGGG - Intronic
1162525917 19:11206310-11206332 TTTGGAAGGCCGAGGCGAGAGGG + Intronic
1162677109 19:12307393-12307415 GCTGGTGGGCAGAGAATAGATGG - Intergenic
1163616490 19:18331978-18332000 GCTGGAGTGCAGTGGCAAGATGG + Intergenic
1164667592 19:30051762-30051784 CCTGGAAGACAGAGGCAAGGGGG + Intergenic
1164771590 19:30813739-30813761 ACTGGGAGGCAGTGGCAAGAGGG + Intergenic
1165204927 19:34175304-34175326 CTTGGAAGGCAGAGGTTACAGGG - Intronic
1166419948 19:42629017-42629039 GCCTGAAGCTAGAGGCTAGATGG - Intronic
1167624800 19:50580632-50580654 GCTGGGAGGCAGAGGTTGCAGGG - Intergenic
1168415732 19:56167015-56167037 ACTGGAAGGCAGAGGTTGTAGGG - Intergenic
925366203 2:3313854-3313876 CGAGGAAGGCAGAGGCAAGAGGG + Intronic
926668071 2:15546849-15546871 GCTGGAAGCCAGAGGCAACCAGG + Intronic
926866387 2:17363640-17363662 GGTAGAAGGCAGAGGGCAGAGGG - Intergenic
927708450 2:25311148-25311170 GGCGGTGGGCAGAGGCTAGAGGG + Intronic
927886472 2:26721606-26721628 GCTGGATGGCAGAGGGCAGCTGG - Intronic
928226810 2:29456538-29456560 GCTGGTTGCCAGGGGCTAGAGGG + Intronic
928786957 2:34899655-34899677 GACTGAAGGCAGAGGCAAGAGGG - Intergenic
929460271 2:42098156-42098178 CCTGGGAGGCAGAGGTTACAGGG + Intergenic
929549138 2:42878371-42878393 GCTGGAAGGCCCAGGGTAGGAGG + Intergenic
929620618 2:43350529-43350551 TGTGGAAGTCAGAGGCAAGAGGG - Intronic
929763611 2:44826205-44826227 TCTGGAGGGCAGAAGGTAGAAGG - Intergenic
929819268 2:45260303-45260325 CCTGAAAGGAAGAGGCTGGAAGG - Intergenic
929915787 2:46134384-46134406 ACTGGATGGATGAGGCTAGAAGG + Intronic
930180266 2:48349120-48349142 GCTGGAATGCAGTGGTGAGATGG - Intronic
931142720 2:59481046-59481068 GGTGGGAGGGAGAGGCTAGAAGG + Intergenic
931216545 2:60250146-60250168 CCTGGGAGGCAGAGGCTTCAGGG + Intergenic
931779099 2:65564553-65564575 GCTGGAGGGCACAGGCTACTGGG - Intergenic
932330753 2:70897085-70897107 GTTGGAAGGGAGATGCCAGACGG - Intergenic
933507212 2:83192687-83192709 TTTGGAAGGCTGAGGCTAGGAGG - Intergenic
933812526 2:86041823-86041845 GCTAGGAGGCAGGGGCTAGGAGG + Intronic
935142613 2:100366691-100366713 CCTGGAAGGCAGAGGTTGCAGGG + Intergenic
935320243 2:101880297-101880319 GCTGTAAAGCAGATTCTAGAAGG - Intronic
936538573 2:113331775-113331797 GGTGGGAGGCAGGGGCTAGTGGG - Intergenic
937256687 2:120560858-120560880 TCTGGAAGGCAAAGGCTAGAGGG + Intergenic
937547916 2:123047312-123047334 GCAGGATAGCAGAGGCTACAAGG + Intergenic
938592296 2:132751302-132751324 GCTGGAAGGCAAAGGGAAGCAGG - Intronic
939153706 2:138501245-138501267 GCTGGAAGTCTCAGGCCAGAAGG - Intergenic
940787196 2:157994235-157994257 GGTGGAAGGCAGAGGAGAGCAGG + Intronic
941010847 2:160297831-160297853 GCAGGAAGGCAGAGGATGGAGGG + Intronic
941227730 2:162869061-162869083 TCTGGAAGTCAGGGACTAGAGGG - Intergenic
941239960 2:163025001-163025023 ACTGGAGGGCAGAGGGTAGGAGG + Intergenic
941651962 2:168101660-168101682 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
943032365 2:182700839-182700861 TCTGGAAGGCAGAGGTTGCAAGG + Intergenic
943637205 2:190319514-190319536 GCTGCAAAGAAGATGCTAGAGGG + Intronic
944498280 2:200330713-200330735 GCTGGAAGGCAACAGCTTGATGG + Intronic
944673043 2:202011964-202011986 CCTGGAAAGCTGAGGCCAGAGGG + Intergenic
944773392 2:202936438-202936460 GGTGGATGCCAGAGGCTTGAGGG - Intronic
944919285 2:204394493-204394515 GGTGGAAAGCAGAGGCCAGTAGG + Intergenic
945065637 2:205945635-205945657 GCTGAGAGGCAGAGGCTGGTAGG - Intergenic
945068407 2:205966722-205966744 TCTGGAGGGGAGAGGCTGGAGGG + Intergenic
945261080 2:207843973-207843995 CCTGGGAGGCTGAGGCTGGAGGG + Intronic
945309511 2:208294877-208294899 GCTGGAAGCCAGAAGCCGGAGGG + Intronic
946150957 2:217770178-217770200 TCTGGAAGTCAGAGTCTAAATGG + Intergenic
947686826 2:232094641-232094663 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
947751861 2:232536975-232536997 GCTGGAAGGCAGAAGTTACTAGG - Intergenic
948263494 2:236621438-236621460 GGGTGAAGGCAGAGGCGAGAAGG - Intergenic
948298630 2:236885120-236885142 GCTGGAGGGCAGTGTCAAGATGG + Intergenic
948371776 2:237494215-237494237 GGTGGAGGGCAGAGGGCAGAAGG + Intronic
948458667 2:238118836-238118858 GGTGGAAGGAAGAGGGTGGATGG + Intronic
948458765 2:238119218-238119240 GGTGGAAGGAAGAGGGTGGATGG + Intronic
1169192624 20:3667812-3667834 GCTGGCAGGCCGAGCCTAGGTGG - Intergenic
1169436431 20:5596154-5596176 GCTGGGAGGCTGAGGCGGGAGGG + Intronic
1169555147 20:6741453-6741475 GCCAGAAGCCAGAGGCTACAAGG + Intergenic
1170588878 20:17756018-17756040 GGGGGAAGGCAGAGGGTAGGAGG + Intergenic
1170695306 20:18652451-18652473 GCTGGCAGGCTGAGTCTGGAGGG + Intronic
1171027077 20:21640590-21640612 GCAGGAAGACAGAGCCAAGATGG + Intergenic
1171225350 20:23437977-23437999 CCTGGGAGGCTGAGGCTAGGAGG - Intergenic
1171228517 20:23461971-23461993 ATTGGAAGGCAGAGGGTAGGAGG - Intergenic
1172010590 20:31843794-31843816 GCTGCAGGTCAGAGGCTGGAGGG + Intergenic
1172115763 20:32572684-32572706 GATGGAAGCCAGAGGTCAGAGGG - Intronic
1172811642 20:37652196-37652218 CCTGGAAGGAAGAGGAGAGAGGG + Intergenic
1173272469 20:41550303-41550325 GCTGATAGGCAGACGCTACATGG - Intronic
1173580729 20:44144826-44144848 GCTGGCAGGCAGTGGTGAGAAGG + Intronic
1174276453 20:49407956-49407978 CCTGGAAAGCGGAGGCTAGAGGG - Intronic
1174597182 20:51693378-51693400 GCTGGTAGGCAGAGGAGAGAGGG + Intronic
1174789524 20:53464536-53464558 GCTGGGAGGTAGAGGCTGCAGGG - Intronic
1175662858 20:60832052-60832074 GCTGGATGGAAGAGGATTGAAGG - Intergenic
1176002052 20:62836610-62836632 GCTGGAAAGCAGTGGCACGAAGG - Intronic
1176077533 20:63255061-63255083 GCTGGAAGGCTGAGACCTGAAGG + Intronic
1176192500 20:63818780-63818802 ACTGGAAGGCAGAGGTTGCAAGG + Intronic
1177828674 21:26112184-26112206 GCTCCAAGGCAGAGGCTTGGAGG + Intronic
1179128632 21:38614522-38614544 GTTGGCAGGCAGTGGCTAGAAGG + Intronic
1179128649 21:38614614-38614636 GGTGGCAGGCAGTGGCTAGAAGG + Intronic
1179875921 21:44267362-44267384 GCTGGAGGGCAGAGGGCACACGG - Intergenic
1180788630 22:18561171-18561193 GCTGGAGTGCAGTGGCGAGATGG + Intergenic
1181010820 22:20039551-20039573 CCTGGGAGGCAGAGGTTACAGGG + Intronic
1181043393 22:20203477-20203499 GCTGGGAGGTGGAGGCTGGAGGG + Intergenic
1181129828 22:20724530-20724552 TCTGGGAGGCAGAGGCTGCAAGG + Intronic
1181233108 22:21434147-21434169 GCTGGAGTGCAGTGGCGAGATGG - Intronic
1181245543 22:21500696-21500718 GCTGGAGTGCAGTGGCGAGATGG + Intergenic
1181545439 22:23599688-23599710 GCTGGAGGGCAGAGGGAGGAAGG - Intergenic
1181776195 22:25161612-25161634 GCTGGAAGGGAGCTGCTGGAGGG + Intronic
1181814871 22:25430211-25430233 GCTGGAGGGCAGAGGGAGGAAGG + Intergenic
1182150130 22:28021857-28021879 GCTGGAAGGGAGGGGTGAGAAGG + Intronic
1182360807 22:29745349-29745371 GCTGGAAGGGAGAGGCCGGCAGG + Intronic
1182453261 22:30433595-30433617 CCTGGAAGGCACAGGTTGGAAGG - Intergenic
1183692619 22:39399463-39399485 GCCGGAAGGCAGAGGTTGCAGGG + Intergenic
1184146921 22:42617197-42617219 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1185211035 22:49570591-49570613 GCAGGAAGCCAGAGGCTGGTGGG - Intronic
949211739 3:1511380-1511402 CGTGGGAGGCAGAGGCTGGATGG - Intergenic
949459113 3:4271547-4271569 GCTGGAATGCAGTGGCGTGATGG + Intronic
949479155 3:4477003-4477025 GCTGGAATTCAGAGGCAAAAGGG + Intergenic
950452445 3:13072946-13072968 GCCTGAAGCCAGAGGCCAGAGGG - Intronic
950529617 3:13545673-13545695 GCTGGAAGAGGAAGGCTAGAGGG + Intergenic
950856083 3:16106628-16106650 GCAGGAAGGCAGATGCTGGCAGG - Intergenic
951179931 3:19647636-19647658 GATGGAAGACAGAGGAGAGAAGG + Intergenic
951535677 3:23738376-23738398 CCTGGGAGGCAGAGGTTACAGGG + Intergenic
952049807 3:29370883-29370905 CCTACATGGCAGAGGCTAGAGGG + Intronic
952117308 3:30198199-30198221 GCTGAAAGTCAGAGGTGAGAGGG + Intergenic
953107139 3:39894292-39894314 TCTGGAAGGCAGTGGCTAGATGG - Intronic
953334202 3:42080007-42080029 GCTGGAAGGCAGTGTGTTGAAGG + Intronic
953412670 3:42698993-42699015 GCTGGCAGGGAGAGGCTGGGTGG + Intronic
953842499 3:46400455-46400477 GCTGATAGTCAGAGGCTGGAAGG + Intergenic
954458276 3:50611688-50611710 GCTGGACGGCGGCGGCTGGAGGG + Exonic
954787328 3:53103610-53103632 GGAGGAAGGCAGAGGGCAGACGG - Intronic
954907630 3:54076397-54076419 TATGCAAGGCAGAGGCAAGAGGG - Intergenic
954973028 3:54667378-54667400 CCTCCAAGGCAGAGGCTGGAAGG + Intronic
955880535 3:63539877-63539899 GGTGGAAGTCAGTGGGTAGATGG - Intronic
956445056 3:69318017-69318039 GCTGGAATGCAGAGGCACAAAGG + Intronic
956892394 3:73625074-73625096 GCTGGAAGGCAGAAGCGCGTGGG + Intergenic
957053491 3:75427448-75427470 GCTGGAAGGCAGAGAGCTGATGG + Intergenic
959672075 3:108990084-108990106 GGTGGAAGGCAGAGGAGAAAAGG - Intronic
960912054 3:122659015-122659037 GCTGGGAGGCAGAGGCCAGGAGG + Intergenic
960928401 3:122819194-122819216 GCTGGAATGCAGTGGCACGAAGG - Intronic
961101596 3:124203529-124203551 GCTGGAAGAGAGAGGTTGGAGGG + Intronic
961670072 3:128522712-128522734 GCCGGATGGGAGAGGCTGGACGG + Intergenic
961887144 3:130103762-130103784 GCTGGAAGGCAGAGAGCTGATGG + Intronic
962342513 3:134597212-134597234 CCTGGATGGCAGGGGCAAGAGGG + Intergenic
962648832 3:137467435-137467457 GCAGGAAGGCAGAAAATAGATGG - Intergenic
962867771 3:139461837-139461859 CCTGGCAGGCAGAGGGAAGAGGG - Intronic
963442265 3:145355463-145355485 ATTGGAAGGCAGAGTCTGGATGG + Intergenic
963790820 3:149580687-149580709 ACCGGAAGGCAGAGGCTGCAGGG - Intronic
964093832 3:152908423-152908445 ACTGGAAAACAGAGGCTATATGG - Intergenic
965899227 3:173618241-173618263 GCTGGAATGCAGTTGCAAGATGG + Intronic
966193764 3:177294207-177294229 GCTGAAAGCCAGACACTAGAAGG + Intergenic
966459885 3:180165284-180165306 CCAGGAAGGCAGGGGTTAGATGG + Intergenic
966855830 3:184193343-184193365 GCTGGAAGGCAGAACCAGGAAGG - Exonic
967458738 3:189720941-189720963 GCTGGAGGGGTGAGGCCAGAGGG + Intronic
968086021 3:195874265-195874287 GGCGGAAGGGAGAGGCCAGACGG - Intronic
968338886 3:197937841-197937863 ACTGGAAGCCAGAAGCTTGAGGG + Intronic
968969853 4:3788146-3788168 GCTGGAGGGCTGGGGCCAGATGG - Intergenic
969686913 4:8680730-8680752 GCTTGCAGGCAGAAGCTAGAGGG + Intergenic
969757700 4:9160927-9160949 GCTGGAAGGCAGAGAGCTGATGG - Intergenic
969817678 4:9698440-9698462 GCTGGAAGGCAGAGAGCTGATGG - Intergenic
969926981 4:10594276-10594298 GATGGAAGGCAGAGGATGGGGGG - Intronic
970233310 4:13933145-13933167 GTTGGAAGGCAGAAGCAGGAGGG + Intergenic
970321142 4:14876774-14876796 ACTGGAGGGCAGAGGGTAGGAGG + Intergenic
970324037 4:14904510-14904532 GCTGAAATGCAGAGGTTAAATGG - Intergenic
970523059 4:16904627-16904649 GCCTGAAGGCAGACACTAGATGG - Intergenic
971287898 4:25307985-25308007 ACTGGAAGGCAGAGGCTGCCGGG + Intergenic
971333424 4:25701269-25701291 GCCGGGAGGCAGAGGCTGCAGGG - Intergenic
971372061 4:26027759-26027781 GCTGGAAGGCAGAGTCTGGTTGG + Intergenic
973562395 4:52150144-52150166 TCAGGAAAGCAGAAGCTAGAGGG + Intergenic
974469711 4:62302690-62302712 GCTGGAAAGGGGAGGGTAGATGG + Intergenic
976431497 4:84966923-84966945 TCTGGAAGGCAGTGGGGAGAGGG - Intergenic
976530977 4:86151476-86151498 GCTGGAAGGCTGAGCCCAGCTGG - Intronic
978504631 4:109443482-109443504 TCTGGGAGGCAGAGGTTGGAGGG - Intronic
978787904 4:112630440-112630462 CCTGGGAGGCAGAGGCTTCAGGG + Intronic
979524420 4:121702373-121702395 GGAGGAAGGCAGAAGGTAGAAGG + Intergenic
981748012 4:148069367-148069389 CCTGGAAGGCAGAAGCCAGTAGG - Intronic
981748605 4:148073150-148073172 CCTGGAAGGCAGAGGCATGCTGG - Intergenic
981824500 4:148924664-148924686 ACTGGAAGTCAGAGGCAAAAAGG + Intergenic
983614204 4:169683817-169683839 CCTGGAAGGCAGAGGTTGCAGGG - Intronic
984902747 4:184599664-184599686 CCTGGAGGTCAGAGGCAAGATGG - Intergenic
984970818 4:185188261-185188283 CTTTGAAGGCTGAGGCTAGAGGG - Intronic
985541804 5:490859-490881 GCTGGACGGCAGGGACTACAGGG + Intronic
985776714 5:1848163-1848185 GGTGGTAGGAGGAGGCTAGATGG + Intergenic
986045207 5:4030211-4030233 GCTGGAAGCCAGTGGCAAGAAGG - Intergenic
986332653 5:6728659-6728681 GCTGGGCGGCAGAGCCCAGAGGG + Intronic
987710316 5:21495860-21495882 CTTGGAAGGCTGAGGCAAGAGGG - Intergenic
991410117 5:66337428-66337450 GCTGGAAGGCAGTGCCTTGTGGG - Intergenic
991737550 5:69641509-69641531 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
991760644 5:69914916-69914938 CTTGGAAGGCTGAGGCAAGAGGG - Intergenic
991786688 5:70203185-70203207 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
991789126 5:70221235-70221257 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
991813876 5:70496341-70496363 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
991817007 5:70517625-70517647 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
991839875 5:70789966-70789988 CTTGGAAGGCTGAGGCAAGAGGG - Intergenic
991879133 5:71203570-71203592 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
991881573 5:71221599-71221621 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
992432147 5:76719511-76719533 CCTGGAAGGCAGAGGTTGCAGGG + Intronic
992586840 5:78249615-78249637 GCTGTGTGGCACAGGCTAGACGG + Intronic
994422269 5:99535961-99535983 CTTGGAAGGCTGAGGCAAGAGGG - Intergenic
994508663 5:100675152-100675174 CCTGGAAGGCGGAGGCTGCAGGG - Intergenic
994899785 5:105757077-105757099 CCTGGAAGGCTGAGGCAGGATGG + Intergenic
996853760 5:127981597-127981619 GGTTGAAGGCAGAGGTTAAAGGG + Intergenic
996854138 5:127986172-127986194 TTTGGAAGGCAGAGGCTGGTGGG - Intergenic
997325855 5:133020366-133020388 CCTGGGAGGCAGAGGCTGCAAGG + Intronic
997414011 5:133711287-133711309 TGTGTGAGGCAGAGGCTAGATGG + Intergenic
997576480 5:134981408-134981430 GCTGGGAGGCAGAGGTTGCAGGG + Intronic
998392310 5:141795266-141795288 GCTGGAAGTCAGATGAGAGAAGG - Intergenic
999370119 5:151049844-151049866 GATGGAAGGGACAGGCAAGAAGG - Exonic
999670704 5:153956968-153956990 TCGGGAAGGCAGAGACAAGAGGG - Intergenic
999757614 5:154676770-154676792 GCTACAAGTCAGAGGATAGATGG - Intergenic
1000205327 5:159052632-159052654 GCTGGAATTCAGAGACTGGACGG + Intronic
1000286740 5:159833420-159833442 GCTGGAAGGCAGGGAATGGAGGG - Intergenic
1000658343 5:163909230-163909252 GGTGGCAGGCACAGGCTTGATGG - Intergenic
1000822955 5:166007993-166008015 GCTGGAGGGCAGAGGGAAGAGGG - Intergenic
1001098152 5:168792178-168792200 GCTGGAAGGCAGATGGGAGATGG + Intronic
1001450892 5:171823472-171823494 TCTAGAAGGCAGAGGCTGTAAGG - Intergenic
1001625153 5:173126214-173126236 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1001699491 5:173696551-173696573 GCTGGGAGGCATAGGCAGGAAGG - Intergenic
1002088793 5:176792635-176792657 GCTGGAAGGCAGGGGCAACAGGG + Intergenic
1002586639 5:180252882-180252904 TCTGGAAGACAGAGGTTAGTGGG - Intronic
1003221366 6:4163729-4163751 GCTGGAAGACAGCAGCTGGAGGG + Intergenic
1004037603 6:11938861-11938883 TCTGTAAGGCAGGGGGTAGATGG + Intergenic
1004493480 6:16140738-16140760 GCTGGAAAGCTGGGGCCAGATGG + Intronic
1004522233 6:16372838-16372860 CCTGGGAGACAGAGGCTATAGGG + Intronic
1004547921 6:16616462-16616484 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1005008042 6:21309817-21309839 GCTGAAAGGCAGCGGGGAGAGGG - Intergenic
1005115071 6:22327056-22327078 GCAGGAAGGCAGAAGCAAGAGGG + Intergenic
1005547374 6:26884650-26884672 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
1005622074 6:27629312-27629334 CCTGGAAGGCAGAGGTTGCAGGG + Intergenic
1006801952 6:36765304-36765326 GCAGGAGGGCAGGGGCGAGAAGG - Intronic
1006919792 6:37619871-37619893 GCTGGGAGGCAGTGGGTAGCGGG - Intergenic
1007058618 6:38914679-38914701 GCTGAAAGTCTGAGACTAGAAGG - Intronic
1007189795 6:40003734-40003756 GCAGGAAATCAGAGGTTAGAAGG + Intergenic
1007459080 6:42003889-42003911 GCTGGAATGCAGTGGCATGATGG - Intronic
1007849859 6:44792671-44792693 GCTGGAGTGCAGTGGCGAGATGG + Intergenic
1008577224 6:52872746-52872768 GGTGGAAGGCAAGGGCAAGAGGG + Intronic
1008875276 6:56319263-56319285 TCTGGTAGGCAGAGTCAAGAGGG + Intronic
1009018134 6:57925722-57925744 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
1009023777 6:57973263-57973285 GCTGGAAGGCTGAGGAGACAGGG - Intergenic
1009199354 6:60724814-60724836 GCTGGAAGGCTGAGGAGACAGGG - Intergenic
1009893321 6:69715769-69715791 ACTGGAGGGCAGAGGGTGGAAGG - Intronic
1011275145 6:85623486-85623508 TCTGGGAGGCAGAGGCTGCAGGG + Intronic
1011994601 6:93569254-93569276 GCTGAAGGGCAATGGCTAGAGGG + Intergenic
1012375679 6:98559375-98559397 GTTAGAAGGGTGAGGCTAGAAGG - Intergenic
1012448955 6:99334841-99334863 GCAGGTGGGCAGTGGCTAGATGG - Intronic
1013434314 6:110086810-110086832 GTTGGAAGGCTGAGGCTGGAGGG - Intergenic
1014725161 6:124963356-124963378 GCAGCAAGGCAGGGGCTTGATGG - Exonic
1014887220 6:126796544-126796566 GATGGAAGGAAGTGGCTGGAAGG - Intergenic
1015120441 6:129695518-129695540 GCTTGAAGCCTGAGGCTTGAAGG - Intronic
1015284215 6:131466553-131466575 GTTGGAAGGCTGAGCCTAGCAGG + Intergenic
1015688778 6:135896822-135896844 GCTGGAAGGAAGGAGCTGGAAGG - Intronic
1016810242 6:148253794-148253816 TCTGGAAGGCAGAGGATGCAGGG + Intergenic
1017334798 6:153243497-153243519 GATGGAAGGTAGAGCCTGGAAGG - Intergenic
1017716669 6:157218049-157218071 GCTGGAAAGAGGAGGCAAGAAGG + Intergenic
1018041836 6:159931401-159931423 GCTGGTTGCCAGAGGCTGGAGGG + Intergenic
1019539026 7:1543317-1543339 ACTGGAAGGGAGAGGCTGCATGG - Exonic
1019558884 7:1646103-1646125 CCTGGGAGGCAGAGGCTGCAGGG - Intergenic
1019701482 7:2476626-2476648 GCTGGAAGGGAGAGGCCCGAGGG - Intronic
1020043832 7:5024829-5024851 GTTGGGAGACAGAGGCTGGATGG + Intronic
1020166973 7:5814922-5814944 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1020386988 7:7617365-7617387 GGTGGTAGCCAGAGACTAGAGGG + Intergenic
1022395834 7:29987849-29987871 GCAGGAAGGCTGAGGCCAGCGGG - Intronic
1022699955 7:32750362-32750384 CCTGGGAGGCGGAGGCTACAGGG + Intergenic
1023246091 7:38205811-38205833 ATTAGAAGGCAGAGGGTAGAGGG - Intronic
1023596375 7:41833258-41833280 GCTGGAAAGCAGAGGAAACACGG - Intergenic
1023795437 7:43788245-43788267 ACTGGAAGACAGAGGCAGGAGGG + Intronic
1025113367 7:56237771-56237793 GCTGGGAGGCCGAGGCAGGAGGG - Intergenic
1026489000 7:70846509-70846531 ATTGGAAGGCGGAGGCTGGATGG - Intergenic
1026489257 7:70848629-70848651 ATTGGAAGGCGGAGGCTGGATGG - Intergenic
1027201897 7:76069251-76069273 CCTGGAAGGCAGGAGCTAGAGGG - Intergenic
1029258054 7:99282720-99282742 GCTGGGAGGCTGAGGCGAGAGGG + Intergenic
1029861357 7:103575951-103575973 CCTGGAAGGCGGAGGTTACAGGG - Intronic
1029923200 7:104287851-104287873 TTTGGAAGGCTGAGGCTGGAGGG - Intergenic
1031984596 7:128155325-128155347 CCTGGAAGGCAGAGAGGAGAGGG + Intergenic
1032528730 7:132602409-132602431 GCTGGTAGACAGAGGCAACATGG - Intronic
1032762148 7:134953398-134953420 CCTGGGAGGCAGAGGTTAGCTGG + Intronic
1033196290 7:139330414-139330436 GCTGGAAGTAAGAGGCAAAAAGG - Intergenic
1033690984 7:143736867-143736889 TCTGGGAGGCCGAGGCTAGGTGG - Intergenic
1034072997 7:148205818-148205840 GCTGGAGGCCAGGGGCTAGCTGG + Intronic
1034655423 7:152725656-152725678 CCTGGAAGGTAGAGGCTGCAGGG - Intergenic
1034921398 7:155085497-155085519 GCTAGGAGGCCGAGGCTAGTAGG + Exonic
1036380963 8:8236256-8236278 GCTGGAAGGCAGAGCGCTGATGG - Intergenic
1036848615 8:12186373-12186395 GCTGGAAGGCAGAGAGCTGATGG + Exonic
1036869977 8:12428654-12428676 GCTGGAAGGCAGAGAGCTGATGG + Exonic
1037161654 8:15780631-15780653 GCTGGAAGTCTAAGGCTAGTTGG - Intergenic
1037437425 8:18877783-18877805 ACTGGAAGGCTGAGGCGGGAGGG - Intronic
1037475849 8:19256939-19256961 CCTGGAAGGCAGAGGTTGCAGGG + Intergenic
1038157658 8:25005935-25005957 GTTGGGAGGCTGAGGCAAGAGGG + Intergenic
1038193221 8:25343072-25343094 CCTGGGAAGCAGAGGTTAGAGGG - Intronic
1038737953 8:30189394-30189416 GCTGGGAGGCTGAGGCAGGAGGG - Intergenic
1039241844 8:35565908-35565930 GTTGGCAGGCAAAGGCAAGAGGG - Intronic
1040290365 8:46121111-46121133 TCAGGAAGGCAGAGGGGAGAAGG - Intergenic
1040363356 8:46688882-46688904 TTTGGAAGGCTGAGGCTAGGAGG - Intergenic
1040388842 8:46932869-46932891 GCTGGAAGGCAGATCCTGGTGGG - Intergenic
1040598930 8:48865497-48865519 CCTGGAAGGCAGAGGCCTGAGGG + Intergenic
1040637261 8:49289815-49289837 GCTGGAAGGCAGGAGCATGACGG - Intergenic
1041207242 8:55511425-55511447 GGGGGAAGGCAGAAGGTAGAGGG - Intronic
1041478695 8:58294567-58294589 TCTAGAAGGCTGAGGCAAGAGGG - Intergenic
1042184443 8:66122725-66122747 TCTAAAAGGAAGAGGCTAGAAGG - Intergenic
1042229169 8:66539774-66539796 GCAGGAAGGCGGAGGTTAGTGGG - Intergenic
1042815168 8:72870168-72870190 GCTGGTTGCCAGGGGCTAGAGGG + Intronic
1043388629 8:79770127-79770149 TCTGGAAGGCAGAGGGGAGCAGG - Intergenic
1043457221 8:80424706-80424728 GCTGGAAAGCAAAGCCTAGAAGG - Intergenic
1043968226 8:86503274-86503296 CCTGGAAGGCAGAGGTTGCAGGG + Intronic
1045070509 8:98499456-98499478 GACAGTAGGCAGAGGCTAGAAGG + Intronic
1045707883 8:104947762-104947784 GCTGGAGGGCAGATGATGGAAGG - Intronic
1045718831 8:105081573-105081595 ACTTGAGGGAAGAGGCTAGAAGG + Intronic
1047059924 8:121213867-121213889 GCTAGAAGGCACAAGCAAGAGGG + Intergenic
1047628285 8:126678819-126678841 GCTGGCAAGCAGAGGCTGGACGG - Intergenic
1047681071 8:127254580-127254602 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1047764059 8:127976007-127976029 GTAGGAAGGCTGAGGCTAGCAGG + Intergenic
1047779220 8:128098105-128098127 GGGGGAAGGCAGAGAGTAGAGGG - Intergenic
1048172342 8:132119420-132119442 GATGGAAGGCAGAAGTCAGAAGG + Intergenic
1048221038 8:132542134-132542156 TTTGGAAGGCAGAGGCGGGAAGG + Intergenic
1048365871 8:133738111-133738133 GGTGGAAGACACAGGCTGGATGG - Intergenic
1048385996 8:133913110-133913132 CCTGGAGGGCAGAGGCCAGGTGG - Intergenic
1049015893 8:139919809-139919831 ACAGGAAGGCAGTGGCTTGAGGG + Intronic
1049411294 8:142475138-142475160 GATGGTAAGCAGAGGGTAGAGGG - Intronic
1049446826 8:142635096-142635118 GGTGGGAGGCAGAGGCCAGAGGG - Intergenic
1049454481 8:142680157-142680179 GCTGGAAGGCCGAGGCCTGGAGG + Intronic
1049497699 8:142944176-142944198 GCTGGAAAACAGAGGGCAGAGGG + Intergenic
1049600015 8:143503410-143503432 GATGGAAGGCAGAGGCTGCTGGG - Intronic
1051088773 9:13381914-13381936 GCTGGAAGGCAGAAGCAATGAGG - Intergenic
1051209279 9:14724511-14724533 TTTGGGAGGCAGAGGCAAGATGG - Intergenic
1051262380 9:15277065-15277087 GCTAGAGGGTAAAGGCTAGAGGG - Intronic
1051454903 9:17244458-17244480 TTTGGAAGGCAGAGGCAGGAGGG - Intronic
1051731179 9:20144606-20144628 GATGGATGGCAGAGGGTAGTGGG + Intergenic
1052836997 9:33258218-33258240 CCTGGCAGGCAGAGGCTACAGGG + Intronic
1053221778 9:36318594-36318616 CCTGGGAGGCAGAGGTTACAGGG + Intergenic
1055052581 9:71995142-71995164 GCTGGAATGCAGAGGATTCACGG + Intergenic
1055226293 9:74001348-74001370 GCTTGAAGGCAGAGGCAGGGAGG - Intergenic
1056399012 9:86209105-86209127 GCTGGAACTCAGAAGGTAGAAGG - Intergenic
1056436847 9:86582908-86582930 ACTGGAGGGCAGAGGGTAGGAGG + Intergenic
1057488139 9:95502166-95502188 GCTGGAGGGGAGAGGGTAGGGGG - Intronic
1057786862 9:98094421-98094443 GCGGGAAGGGAGAGGGGAGATGG + Intronic
1057939311 9:99266937-99266959 GCTAGGAGGCAGAGGAAAGAAGG - Intergenic
1059213488 9:112537179-112537201 CCTGGAAGGCAGAGGTTCCAGGG - Intronic
1059431202 9:114251392-114251414 GGAGGAAGGCAGAGGCCCGAGGG - Intronic
1060993821 9:127864351-127864373 TTTGGAAGGCAGAGGCGGGAGGG + Intergenic
1061153949 9:128845912-128845934 GGTGGAAAACAGAGGCTGGAGGG + Intronic
1061376295 9:130226637-130226659 GCTGGGAGGAGGAGGCTGGAAGG + Intronic
1061402920 9:130378285-130378307 GCTGGGAGGGAGAGGCTGGGAGG + Intronic
1062192031 9:135253076-135253098 GCACAAAGGCAGAGGCTGGAGGG + Intergenic
1203563219 Un_KI270744v1:74505-74527 GCTGCCTGGCAGAGGCTGGATGG - Intergenic
1203582440 Un_KI270746v1:22849-22871 AATGGAAAGCAGAGGTTAGAAGG + Intergenic
1185513015 X:677207-677229 GCTGGGAGGCAGAGGTTGCAGGG + Intergenic
1185642146 X:1594261-1594283 GCTGGAAGGAAGTCGCCAGAGGG - Intronic
1185820585 X:3199219-3199241 GCTGGAGTGCAGAGGCTTCAGGG - Intergenic
1185972707 X:4682297-4682319 CCTGGGAGGCAGAGGCTGCACGG + Intergenic
1186033712 X:5397502-5397524 GCAAAGAGGCAGAGGCTAGAGGG + Intergenic
1188307337 X:28574162-28574184 GCTGGAAGGAAGAGGAGACAAGG + Intergenic
1188711357 X:33404530-33404552 ACTGGAAGGTAGAGGATAGGAGG - Intergenic
1190061583 X:47215064-47215086 GGTAGAAGGCAGTGGCAAGAGGG - Exonic
1191696773 X:63998052-63998074 GCTGGAATGCAGTGGCATGATGG + Intergenic
1193699671 X:84745538-84745560 CCTGGGAGGCGGAGGCTACAGGG - Intergenic
1193941400 X:87683540-87683562 GGAGGAAGGCAGAGGTCAGATGG - Intergenic
1194162356 X:90469672-90469694 GCTGGAAGGGGAAGTCTAGATGG - Intergenic
1195413792 X:104598270-104598292 GCTGGAAGGCAGAGGGTTGTAGG + Intronic
1195707752 X:107750355-107750377 GTGAGAAGGCAGAGGCTAAAAGG + Intronic
1195925116 X:110017259-110017281 GCTGGAAGGTTAAGGATAGAAGG - Intronic
1196864705 X:120060341-120060363 GCTGGGAGCCAGAGGGGAGAGGG - Intergenic
1196878396 X:120175990-120176012 GCTGGGAGCCAGAGGGGAGAGGG + Intergenic
1197655520 X:129112469-129112491 GGTGTAAGGAAGAAGCTAGATGG + Intergenic
1198252134 X:134890025-134890047 GCTGGAGGGCAGTGGCTGGCTGG - Intronic
1200137588 X:153882591-153882613 GCTGGAGGGCAGGGGGCAGAGGG + Intronic
1200508635 Y:4047406-4047428 GCTGGAAGGGGAAGTCTAGATGG - Intergenic
1201011222 Y:9549272-9549294 CCAGGAAGACTGAGGCTAGAGGG + Intergenic
1201368818 Y:13238106-13238128 CCTGGAAAGCAGGGGTTAGAGGG - Intergenic
1201784875 Y:17764286-17764308 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1201816677 Y:18141701-18141723 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1201853441 Y:18514867-18514889 CCTGGAAGGCAGAGGCTGCTGGG + Intergenic
1201879880 Y:18805517-18805539 CCTGGAAGGCAGAGGCTGCTGGG - Intronic
1202116013 Y:21469325-21469347 CCGGGAAGACTGAGGCTAGAGGG + Intergenic
1202344692 Y:23909107-23909129 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1202526076 Y:25760976-25760998 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic